ID: 1071699142

View in Genome Browser
Species Human (GRCh38)
Location 10:87910508-87910530
Sequence CACTTGAACCTGGCGGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68307
Summary {0: 3, 1: 11, 2: 614, 3: 15176, 4: 52503}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071699142_1071699149 9 Left 1071699142 10:87910508-87910530 CCTCCTCCCGCCAGGTTCAAGTG 0: 3
1: 11
2: 614
3: 15176
4: 52503
Right 1071699149 10:87910540-87910562 CTTCAGCCTCCCAAGTAGCTGGG 0: 4787
1: 103669
2: 213703
3: 253185
4: 266709
1071699142_1071699148 8 Left 1071699142 10:87910508-87910530 CCTCCTCCCGCCAGGTTCAAGTG 0: 3
1: 11
2: 614
3: 15176
4: 52503
Right 1071699148 10:87910539-87910561 GCTTCAGCCTCCCAAGTAGCTGG 0: 3408
1: 90522
2: 200665
3: 240156
4: 233205
1071699142_1071699151 17 Left 1071699142 10:87910508-87910530 CCTCCTCCCGCCAGGTTCAAGTG 0: 3
1: 11
2: 614
3: 15176
4: 52503
Right 1071699151 10:87910548-87910570 TCCCAAGTAGCTGGGATTACAGG 0: 48553
1: 142115
2: 242012
3: 520212
4: 384467

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071699142 Original CRISPR CACTTGAACCTGGCGGGAGG AGG (reversed) Intronic
Too many off-targets to display for this crispr