ID: 1071699571

View in Genome Browser
Species Human (GRCh38)
Location 10:87915692-87915714
Sequence TATGTCTTTGTGAAGTCTGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 210}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071699571 Original CRISPR TATGTCTTTGTGAAGTCTGG CGG (reversed) Intronic
903460559 1:23517737-23517759 CAGGTGTTTATGAAGTCTGGAGG + Intronic
904221514 1:28973920-28973942 TATGTCTTTGTAATTTCTGTGGG + Intronic
909526328 1:76626762-76626784 TCTGTCTTTGTGAAGGCCAGTGG - Intronic
909607833 1:77524351-77524373 TATGTATATGTGTAGTATGGTGG - Intronic
914728935 1:150353355-150353377 TGTGTATTTTTGAAGTCTAGTGG + Intergenic
915400155 1:155616187-155616209 CCTCTCTTTCTGAAGTCTGGGGG + Intergenic
915417361 1:155752382-155752404 CCTCTCTTTCTGAAGTCTGGGGG + Exonic
917122910 1:171659944-171659966 TGAGTCTTTGTGAAGGCTGCTGG + Intergenic
918559197 1:185844188-185844210 TATGCCTTTGTTTAGTCTTGAGG + Intronic
920087965 1:203431913-203431935 TATGCCTTGGAGAAGACTGGGGG - Intergenic
920281590 1:204847620-204847642 TATGCATTTGGGAAGTCAGGGGG + Intronic
922144681 1:222928830-222928852 CATGTCTTTGTGAAGTTGGAAGG + Intronic
922195171 1:223353445-223353467 TATGTCCCTGTGAAGTCCAGAGG + Intronic
923107375 1:230865162-230865184 TGCCTCTCTGTGAAGTCTGGTGG - Intronic
923230764 1:231984081-231984103 AATGACTTTATGGAGTCTGGGGG - Intronic
923502109 1:234573780-234573802 TATGCCTGTGTGATGTCTAGGGG - Intergenic
924006051 1:239612744-239612766 TATGTCCTTCTGAAGTGAGGTGG + Intronic
1063086907 10:2828081-2828103 TCTGCCTTTCTGAAGTCTGAAGG + Intergenic
1064570603 10:16688826-16688848 TATTTTTTTGTGGAGACTGGGGG - Intronic
1064614083 10:17134800-17134822 TTTTTATTTGTGAAGTCTGTGGG - Intergenic
1068898227 10:62232267-62232289 TATTTCTTTTTGAAGCCTAGAGG - Intronic
1070364570 10:75723827-75723849 GATGCCTTTGTGAAGTATGGGGG + Intronic
1070428104 10:76308928-76308950 TATGTTTGTGTAAAGTCTTGGGG + Intronic
1071307735 10:84314033-84314055 TTTGTGTTTCTGAAGACTGGTGG + Intergenic
1071699571 10:87915692-87915714 TATGTCTTTGTGAAGTCTGGCGG - Intronic
1072653870 10:97317364-97317386 TTTGTTTTTGTCAAGTGTGGAGG - Intergenic
1073367206 10:102952928-102952950 GATGTCATTGTGAAGTCAGTTGG + Intronic
1074376885 10:112948377-112948399 TATTTATTTATGAAGTCTGAAGG + Intergenic
1079928531 11:26527433-26527455 TATGTCTTTGTGGATTCATGTGG + Intronic
1080033871 11:27690612-27690634 TCTTTCATTGTGAAGTCAGGAGG - Intronic
1083190307 11:61046987-61047009 TATGTACTGTTGAAGTCTGGTGG - Intergenic
1083862590 11:65430404-65430426 AATGTGTTTGTGAACTCTGCCGG - Intergenic
1084656885 11:70524915-70524937 CAGGTCTTTGTGGAGTGTGGAGG + Intronic
1085491755 11:76925989-76926011 TTTGTTTTTGTGAAGACAGGAGG + Intronic
1086808266 11:91270507-91270529 TATGTCTCTGTGAAGGACGGTGG + Intergenic
1086960871 11:92979206-92979228 TGTGTCCTTTTGAAATCTGGAGG - Intronic
1087393596 11:97569607-97569629 TCTGTCTTTCTGCAGTCTGGAGG + Intergenic
1089306230 11:117528020-117528042 AACGGCCTTGTGAAGTCTGGAGG - Intronic
1089895755 11:121928600-121928622 TATGTCTTAGGGTAGTTTGGGGG - Intergenic
1089976383 11:122735647-122735669 TATTTCTCTGTGAAATATGGTGG - Intronic
1090491224 11:127162602-127162624 CTTGTTTTTCTGAAGTCTGGAGG + Intergenic
1091150318 11:133322634-133322656 TATGTCTTGGGGAAGGCTGAAGG - Intronic
1091356798 11:134943751-134943773 CCTGTCTTTGTGGTGTCTGGGGG + Intergenic
1094946379 12:35851488-35851510 ACTGTCTTTGTAAAGTCTGCAGG + Intergenic
1094951486 12:35934725-35934747 ACTGTCTTTGTAAAGTCTGCAGG + Intergenic
1094971257 12:36253699-36253721 ACTGTCTTTGTAAAGTCTGCAGG + Intergenic
1094983361 12:36449378-36449400 ACTGTCTTTGTAAAGTCTGCAGG + Intergenic
1095018255 12:37014143-37014165 ACTGTCTTTGTAAAGTCTGCAGG + Intergenic
1096770887 12:53935221-53935243 TGTGTCTTTTTGAAGTCGAGGGG - Intergenic
1098309694 12:69136093-69136115 TATGGCTTTGTGAATGATGGAGG - Intergenic
1098704478 12:73670834-73670856 CATGACTTTGTTAATTCTGGAGG - Intergenic
1100503763 12:95199422-95199444 TTAGTCTTTTAGAAGTCTGGGGG - Intronic
1100805102 12:98275170-98275192 TATGTCTTTCTGAAGTTCAGAGG - Intergenic
1100958542 12:99936712-99936734 TAGGTCTTTGTGGAGTGAGGAGG - Intronic
1101846024 12:108363743-108363765 TGTGTGTTTGTGATGTGTGGGGG + Intergenic
1106866474 13:33969792-33969814 TATATCTTTGTGAAGTAGGTTGG - Intergenic
1106929079 13:34644292-34644314 TTTATCTTAGTGAAGTCTGAAGG - Intergenic
1110782541 13:79482366-79482388 TTTTTCTTTGTGTATTCTGGTGG + Intronic
1115267475 14:31515754-31515776 TATTACTTTGTGAGGGCTGGGGG + Intronic
1115319413 14:32063293-32063315 TCTGTCTTTGTGCAGGCTCGTGG - Intergenic
1115813374 14:37134803-37134825 TATGTCTTGGCCAAGTGTGGTGG + Intronic
1116328446 14:43565111-43565133 TATGGACTTGTGAAGTCTGCAGG + Intergenic
1116657720 14:47673535-47673557 TCTGTGTTTTTGAGGTCTGGTGG - Intronic
1117030119 14:51660174-51660196 TATGTCTTTATGAAGTATTCAGG + Intronic
1119634528 14:76263240-76263262 TACGTCTTTGTGAAGTCGGCAGG - Intergenic
1119769368 14:77210851-77210873 TGTGGCTTTGTGCACTCTGGGGG + Intronic
1123807235 15:23887521-23887543 TATGTTTCTGGGAATTCTGGTGG - Intergenic
1124793381 15:32751398-32751420 TATAACTTTGTGAAGTAGGGAGG + Intergenic
1126192214 15:45889615-45889637 ATTGTCTAGGTGAAGTCTGGGGG - Intergenic
1129500721 15:76035078-76035100 TCTTTCTCTGTTAAGTCTGGAGG + Intronic
1129870841 15:78940071-78940093 TTCGTTTTTGTGAAGTCTTGCGG - Intronic
1133908153 16:10039978-10040000 TGTGTATTTGTGCAGTGTGGAGG - Intronic
1140829394 16:78737442-78737464 TATGTATTTATTAAGTTTGGGGG + Intronic
1142455962 16:90223274-90223296 TATGTCTTTTTCACCTCTGGAGG + Intergenic
1144614958 17:16760909-16760931 TGTATTTTTGTGAATTCTGGTGG + Intronic
1144751670 17:17653117-17653139 TATGTTTTTGTACAGTCTGCAGG - Intergenic
1144897747 17:18554764-18554786 TGTATTTTTGTGAATTCTGGTGG - Intergenic
1145134625 17:20390954-20390976 TGTATTTTTGTGAATTCTGGTGG + Intergenic
1146277116 17:31523059-31523081 TACGTCTCTGGGAACTCTGGGGG - Intronic
1148639055 17:49171239-49171261 TTTGTCTTTGTATAGTCTGCAGG - Intergenic
1149444445 17:56702926-56702948 TATGTGTTTGTGAGGTTTGTGGG + Intergenic
1151103464 17:71583646-71583668 CAGGTCTTTGTGAAGTCATGTGG - Intergenic
1152482611 17:80565303-80565325 AATGACTTTGTGAGGTTTGGTGG + Intronic
1152631100 17:81411018-81411040 TATGTCTGTGTGAAGGCCTGGGG + Intronic
1153481887 18:5555311-5555333 TATGTTTTCTTGAAGTATGGAGG - Intronic
1153501797 18:5757142-5757164 TGTGTCTATGAGAAGTATGGCGG - Intergenic
1155654995 18:28181944-28181966 TATTTCTTTATAAAGTCTGATGG + Intergenic
1156351562 18:36306385-36306407 TAGGTCTTGATGATGTCTGGTGG + Intronic
1156370867 18:36470164-36470186 CATACCCTTGTGAAGTCTGGAGG + Intronic
1156528714 18:37794561-37794583 GAAGTCTTTGAGAAGCCTGGAGG - Intergenic
1159140227 18:64385414-64385436 TATGTCAGTGTGAAGTCTGAAGG - Intergenic
1160095191 18:75865547-75865569 TATGTCATTCTGGAGGCTGGTGG + Intergenic
1161185601 19:2917494-2917516 CATGTCTTTGAAAAGCCTGGGGG - Exonic
1163038729 19:14587264-14587286 TGTGTTTGTGTGAGGTCTGGGGG + Intronic
1165708915 19:37995754-37995776 TATGTCACTGGGAAGTCTGTAGG + Intronic
1167983334 19:53294574-53294596 TATCTCTTTGAGAAGCATGGTGG - Intergenic
928195991 2:29216912-29216934 TATGTCTTTATGGTGTGTGGGGG + Intronic
930031898 2:47063559-47063581 TGAGCCTTTGTGAACTCTGGAGG + Intronic
932090530 2:68801997-68802019 AATGACTTTGTGAATTCTGGTGG + Intronic
934164251 2:89280042-89280064 GATGTGTATGTGAAATCTGGAGG + Intergenic
934203023 2:89902482-89902504 GATGTGTATGTGAAATCTGGAGG - Intergenic
934497999 2:94827234-94827256 TTGGTCTTTGTGAATTCTGAAGG - Intergenic
936048412 2:109204023-109204045 TATATCTTTGAGACGTCAGGAGG + Intronic
937461280 2:122089289-122089311 TATGTATTTGTGTAGTTTTGAGG + Intergenic
938998662 2:136708136-136708158 TATGTCTTTGTGAACTCATTTGG + Intergenic
939279000 2:140038557-140038579 TATGTCATTCTGGAGTCTTGAGG + Intergenic
943248385 2:185485042-185485064 TCTGCCTTTCTGAAGTCTGGAGG - Intergenic
943308108 2:186292234-186292256 TATATCTATTTGAAGTCAGGTGG + Intergenic
944898642 2:204191673-204191695 CATGTCTTGGTGATGGCTGGTGG - Intergenic
945228474 2:207558227-207558249 TATGTGACTGTGAAGCCTGGGGG - Intronic
945627484 2:212228913-212228935 TATGTATATGTGAAGTATGCTGG + Intronic
948355931 2:237377044-237377066 TACATTTTTGTGAAGTCTGCTGG - Exonic
948868994 2:240788955-240788977 TCTGACTTTGGGATGTCTGGGGG + Intronic
949087460 2:242168075-242168097 TATGTCTTTTTCACCTCTGGAGG + Intergenic
1170083506 20:12503171-12503193 ATTTCCTTTGTGAAGTCTGGAGG + Intergenic
1170128083 20:12988069-12988091 AATGTCTTTTTGATGTCTGAAGG - Intergenic
1170233780 20:14079571-14079593 TAAGTGTTTCTGAATTCTGGAGG - Intronic
1171111955 20:22492113-22492135 TATGTTTTTGAGAAGGCTAGTGG - Intergenic
1173024459 20:39295184-39295206 TTTGTCATTGTGAATGCTGGTGG - Intergenic
1175379185 20:58550976-58550998 GAGTTGTTTGTGAAGTCTGGGGG + Intergenic
1176274831 20:64258769-64258791 AATGTCTTCATGAGGTCTGGTGG + Intronic
1177471240 21:21563554-21563576 TCTGCCATTTTGAAGTCTGGAGG + Intergenic
1178090868 21:29161665-29161687 TGTGTGTATGTGAAGTGTGGTGG + Intronic
1178090907 21:29162190-29162212 TGTGTGTGTGTGAAGTGTGGTGG + Intronic
1178353398 21:31889890-31889912 TATGTCCCTTTGAAATCTGGAGG - Intronic
1178448306 21:32665696-32665718 CATGTCATTCTGAATTCTGGAGG + Intronic
1179410042 21:41155476-41155498 TATCTCTTCTTGAAGGCTGGTGG - Intergenic
1181132247 22:20738896-20738918 GATGTCTTTCTTATGTCTGGTGG - Intronic
1181909171 22:26224555-26224577 TTTGTCTTTCTGAAGTCTAGTGG - Intronic
1184947817 22:47816685-47816707 TATCTCTTTCTGAATCCTGGTGG + Intergenic
950193646 3:10994138-10994160 TGTGTCTTTGGGAACTTTGGGGG + Intronic
950414444 3:12860630-12860652 TATTTCCTTGTGAAGTGAGGGGG - Intronic
950414720 3:12862327-12862349 TATTTCCTTGTGAAGTGAGGTGG - Intronic
951437483 3:22681339-22681361 TATGTAATTGAGAAGCCTGGAGG + Intergenic
953038985 3:39238056-39238078 GAAGTCCTTGTGAAGGCTGGTGG + Intergenic
956961744 3:74410884-74410906 TATATCATTATGAAATCTGGAGG - Intronic
958451035 3:94272817-94272839 TATGTATTTGGGCAGTCTTGAGG - Intergenic
959305774 3:104664320-104664342 TAAGTCTGAATGAAGTCTGGAGG - Intergenic
959369918 3:105510485-105510507 AAAGTCTCTGTGAAGTCTAGTGG - Intronic
962742827 3:138375054-138375076 TATTTTTTTGTGAAGATTGGGGG + Intronic
962890582 3:139669075-139669097 TATGTCTTTATTAAGTCTATTGG - Intronic
965248070 3:166301749-166301771 TTTGTCTTTCTTAACTCTGGTGG + Intergenic
965636698 3:170789242-170789264 TATGTACTTGTGAAATCTCGTGG + Intronic
966451920 3:180073059-180073081 TGTGTCTTTGTGATGAGTGGGGG - Intergenic
966760972 3:183418876-183418898 TCTGTCATTGTGGGGTCTGGAGG + Intronic
967628724 3:191717627-191717649 TATGTCATTATGAAGACTGTTGG - Intergenic
968260558 3:197320040-197320062 TTTGTCTTTGTTATGTCTCGTGG + Intergenic
969595383 4:8146124-8146146 AAAGTCTATGTGAAGGCTGGTGG - Intronic
970686902 4:18578792-18578814 TCTGTTTTTGAGAAGCCTGGTGG - Intergenic
972662357 4:41128810-41128832 TTTGTCTTTGGGAAGCCAGGAGG - Intronic
974373958 4:61052362-61052384 TACGTCTTTGAGAAGACTTGGGG - Intergenic
974490284 4:62556277-62556299 TATGTATTTGTATAGTTTGGAGG + Intergenic
974528635 4:63078808-63078830 TATGTGTTTGTGAAAACTAGCGG + Intergenic
974704130 4:65489390-65489412 TATTTCTTTGTGAGTACTGGTGG + Intronic
974969523 4:68807004-68807026 TCTGTTTTAGTGAAGACTGGTGG + Intergenic
976368210 4:84255088-84255110 TTTGACTTTGTGAACTCTTGGGG - Intergenic
977275676 4:94975032-94975054 TTCGTCCTTGTGAAGTCTGTTGG - Intronic
978704332 4:111688273-111688295 TATGTCTATGTTAATTATGGAGG + Intergenic
978750513 4:112241103-112241125 TATGTCTTTGACATGTTTGGAGG + Intronic
979710855 4:123777678-123777700 TATGTCCTTGTAAAGGTTGGAGG + Intergenic
982811064 4:159826523-159826545 TGTGTCTTGCCGAAGTCTGGGGG + Intergenic
984074011 4:175152461-175152483 TAGGTCTTTTTGAATTCTGCAGG + Intergenic
986671120 5:10143903-10143925 TGTGGCTTTGGGAAGACTGGAGG - Intergenic
986926357 5:12757728-12757750 TATCTCTTTCTGTAGTTTGGAGG - Intergenic
988328700 5:29806193-29806215 TATTTCTTGTTGAAGTCTGAAGG - Intergenic
988854815 5:35217620-35217642 TATATTTTTGTAAAGGCTGGAGG + Intronic
989426538 5:41302503-41302525 TAGGGCTTTGTAAAGTCTAGTGG - Intergenic
990306519 5:54498795-54498817 TTTGTCTTTGTATAGTCTGCAGG - Intergenic
992383119 5:76258055-76258077 TATGTGTTTATGTAGTATGGGGG + Intronic
992426213 5:76660204-76660226 GGTGTCTTTATGAGGTCTGGAGG - Intronic
992720678 5:79558480-79558502 CATGTTTTTGAGAAGTATGGGGG + Intergenic
993825866 5:92685609-92685631 TACATCTTTGGGAAGTTTGGAGG - Intergenic
994599570 5:101886007-101886029 ACTGTCTGTGTGGAGTCTGGAGG - Intergenic
996230705 5:121060340-121060362 TAAGTGTATGTGAAGTCTGTAGG - Intergenic
997100040 5:130958579-130958601 TCTGTCTTTCTGGGGTCTGGAGG - Intergenic
999912149 5:156214206-156214228 TAGTTTTTTGTGAAGTCTTGAGG - Intronic
1001117887 5:168955003-168955025 AATGTCTTTGGGCATTCTGGAGG + Intronic
1004230972 6:13833178-13833200 TATTTCTTTGTGGGGTTTGGTGG - Intergenic
1006833261 6:36981672-36981694 TTTGTCTTTGTTAATTCTGAAGG - Exonic
1007017539 6:38483660-38483682 CATGTGTTTCTGAAATCTGGTGG - Intronic
1008102291 6:47404871-47404893 CATGTCTTTGTAAAATCCGGGGG + Intergenic
1010897543 6:81382946-81382968 TATGTCCTTGTGAAATTTGAGGG - Intergenic
1012101395 6:95091204-95091226 TGTGTGTGTGTGAAGGCTGGGGG - Intergenic
1012297992 6:97548344-97548366 TATGTCTTTCTGAAGTGGGATGG + Intergenic
1015648073 6:135417844-135417866 TATGTATTTGTGGAGGCTGGAGG - Intronic
1017364293 6:153615490-153615512 TATATCTTTGAGATGTCTGATGG - Intergenic
1017746925 6:157455517-157455539 CAGGTCTTTCTTAAGTCTGGAGG + Intronic
1022845714 7:34207637-34207659 TTTGACCTTGAGAAGTCTGGAGG + Intergenic
1023509936 7:40941366-40941388 TATGTATTTGTATAGTCTTGAGG + Intergenic
1024919184 7:54539619-54539641 TGTTTCTTTGTGATGTCTGTAGG - Intergenic
1028844190 7:95461168-95461190 TCTATCATTGTGGAGTCTGGAGG - Intergenic
1032104033 7:129009988-129010010 TTTGTCTTTTTGAAGTATGATGG - Intronic
1035356711 7:158280055-158280077 TGTGTCTTGGTGCAGTTTGGGGG - Intronic
1035497267 8:63265-63287 TATGTCTTTTTCACCTCTGGAGG - Intergenic
1036192746 8:6685782-6685804 GATGTCTGTGTGAAGCCAGGTGG + Intergenic
1036290825 8:7488233-7488255 TAGGTCTCTCTGATGTCTGGAGG + Intronic
1043272070 8:78347165-78347187 TATGTCTTTTTAATGTCTGTGGG - Intergenic
1043526437 8:81102378-81102400 TATGCCTTTGTGACATTTGGTGG - Intronic
1043920665 8:85979905-85979927 TATGTCCTTGTGGAGTCATGAGG + Intergenic
1045019943 8:98033502-98033524 TATGCGTCTGGGAAGTCTGGTGG + Intronic
1046724928 8:117663855-117663877 CTTGTCTTTGTCAAGTCTGCAGG - Intergenic
1049383732 8:142330545-142330567 TGTGTCTTTGTCATGTCTGAAGG - Intronic
1051176320 9:14364285-14364307 TTTGGCTTTGTGAAGTTTGTTGG + Intronic
1052083352 9:24233745-24233767 TATGTCTTTGGCAAGTCTTGAGG - Intergenic
1057536408 9:95912461-95912483 TATGTCTTTGTGTACGGTGGTGG + Intronic
1058347507 9:103981337-103981359 TATGCCTCTTTGAATTCTGGTGG - Intergenic
1203694427 Un_GL000214v1:83329-83351 TTGGTCTATGTGAATTCTGGAGG - Intergenic
1203641846 Un_KI270751v1:20734-20756 TTGGTCTATGTGAATTCTGGAGG + Intergenic
1185784177 X:2875882-2875904 TCAGTCTCTGTGAAGTCTGCAGG - Exonic
1186047058 X:5547995-5548017 TATGTCCCTGAGAAGGCTGGTGG - Intergenic
1188238216 X:27754403-27754425 TATGCCATTCTGGAGTCTGGAGG + Intergenic
1188719232 X:33502675-33502697 TATGTATTTGTGTAGTTTTGAGG - Intergenic
1189849416 X:45164025-45164047 TGTGTGTTGGTGAATTCTGGAGG + Intronic
1193725751 X:85037181-85037203 TGTGTCTTTTTCAAATCTGGAGG + Intronic
1196887633 X:120262991-120263013 TTTGTGTTTGAGAAGTATGGGGG + Intronic
1197067662 X:122253132-122253154 TATATCTTTGTGATGGATGGAGG + Intergenic
1197570551 X:128146347-128146369 TATGTCTTTTGGATGTCAGGGGG - Intergenic
1197946201 X:131841675-131841697 TATGTGTGTGAGAAGTATGGGGG - Intergenic
1198023950 X:132686701-132686723 CATGACTCTGTGAAGTCAGGTGG - Intronic
1200601599 Y:5211924-5211946 TATGTCTGGGTCAAGTGTGGTGG - Intronic