ID: 1071712886

View in Genome Browser
Species Human (GRCh38)
Location 10:88067008-88067030
Sequence TGAAACTCGTGTGCTGCAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071712884_1071712886 2 Left 1071712884 10:88066983-88067005 CCCTGGGCTCTCAGTGAAAGCAC No data
Right 1071712886 10:88067008-88067030 TGAAACTCGTGTGCTGCAACAGG No data
1071712885_1071712886 1 Left 1071712885 10:88066984-88067006 CCTGGGCTCTCAGTGAAAGCACA No data
Right 1071712886 10:88067008-88067030 TGAAACTCGTGTGCTGCAACAGG No data
1071712882_1071712886 4 Left 1071712882 10:88066981-88067003 CCCCCTGGGCTCTCAGTGAAAGC No data
Right 1071712886 10:88067008-88067030 TGAAACTCGTGTGCTGCAACAGG No data
1071712883_1071712886 3 Left 1071712883 10:88066982-88067004 CCCCTGGGCTCTCAGTGAAAGCA No data
Right 1071712886 10:88067008-88067030 TGAAACTCGTGTGCTGCAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071712886 Original CRISPR TGAAACTCGTGTGCTGCAAC AGG Intergenic
No off target data available for this crispr