ID: 1071717375

View in Genome Browser
Species Human (GRCh38)
Location 10:88110909-88110931
Sequence CCTGCTTTGCTGGCAGTACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071717375_1071717384 29 Left 1071717375 10:88110909-88110931 CCATGTACTGCCAGCAAAGCAGG No data
Right 1071717384 10:88110961-88110983 GGTTTGTGTGCTGTGTTTAGAGG No data
1071717375_1071717380 8 Left 1071717375 10:88110909-88110931 CCATGTACTGCCAGCAAAGCAGG No data
Right 1071717380 10:88110940-88110962 GAACCTTCCTCCAAAAGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071717375 Original CRISPR CCTGCTTTGCTGGCAGTACA TGG (reversed) Intergenic
No off target data available for this crispr