ID: 1071718412

View in Genome Browser
Species Human (GRCh38)
Location 10:88119870-88119892
Sequence CTTTCTGATTTCTCTGTTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071718412_1071718421 17 Left 1071718412 10:88119870-88119892 CCAGAAACAGAGAAATCAGAAAG No data
Right 1071718421 10:88119910-88119932 TGAAGCGGTAGGACAAGAACAGG No data
1071718412_1071718422 22 Left 1071718412 10:88119870-88119892 CCAGAAACAGAGAAATCAGAAAG No data
Right 1071718422 10:88119915-88119937 CGGTAGGACAAGAACAGGAAAGG No data
1071718412_1071718420 6 Left 1071718412 10:88119870-88119892 CCAGAAACAGAGAAATCAGAAAG No data
Right 1071718420 10:88119899-88119921 CCAGGGCATCTTGAAGCGGTAGG No data
1071718412_1071718417 2 Left 1071718412 10:88119870-88119892 CCAGAAACAGAGAAATCAGAAAG No data
Right 1071718417 10:88119895-88119917 CCCACCAGGGCATCTTGAAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071718412 Original CRISPR CTTTCTGATTTCTCTGTTTC TGG (reversed) Intergenic
No off target data available for this crispr