ID: 1071718416

View in Genome Browser
Species Human (GRCh38)
Location 10:88119895-88119917
Sequence CCGCTTCAAGATGCCCTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071718416_1071718425 24 Left 1071718416 10:88119895-88119917 CCCACCAGGGCATCTTGAAGCGG No data
Right 1071718425 10:88119942-88119964 CTAGGACAGCAAAAGGACAGAGG No data
1071718416_1071718423 6 Left 1071718416 10:88119895-88119917 CCCACCAGGGCATCTTGAAGCGG No data
Right 1071718423 10:88119924-88119946 AAGAACAGGAAAGGTAGACTAGG No data
1071718416_1071718422 -3 Left 1071718416 10:88119895-88119917 CCCACCAGGGCATCTTGAAGCGG No data
Right 1071718422 10:88119915-88119937 CGGTAGGACAAGAACAGGAAAGG No data
1071718416_1071718427 30 Left 1071718416 10:88119895-88119917 CCCACCAGGGCATCTTGAAGCGG No data
Right 1071718427 10:88119948-88119970 CAGCAAAAGGACAGAGGAGGAGG No data
1071718416_1071718421 -8 Left 1071718416 10:88119895-88119917 CCCACCAGGGCATCTTGAAGCGG No data
Right 1071718421 10:88119910-88119932 TGAAGCGGTAGGACAAGAACAGG No data
1071718416_1071718426 27 Left 1071718416 10:88119895-88119917 CCCACCAGGGCATCTTGAAGCGG No data
Right 1071718426 10:88119945-88119967 GGACAGCAAAAGGACAGAGGAGG No data
1071718416_1071718424 17 Left 1071718416 10:88119895-88119917 CCCACCAGGGCATCTTGAAGCGG No data
Right 1071718424 10:88119935-88119957 AGGTAGACTAGGACAGCAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071718416 Original CRISPR CCGCTTCAAGATGCCCTGGT GGG (reversed) Intergenic
No off target data available for this crispr