ID: 1071718419

View in Genome Browser
Species Human (GRCh38)
Location 10:88119899-88119921
Sequence CCTACCGCTTCAAGATGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071718419_1071718429 28 Left 1071718419 10:88119899-88119921 CCAGGGCATCTTGAAGCGGTAGG No data
Right 1071718429 10:88119950-88119972 GCAAAAGGACAGAGGAGGAGGGG No data
1071718419_1071718428 27 Left 1071718419 10:88119899-88119921 CCAGGGCATCTTGAAGCGGTAGG No data
Right 1071718428 10:88119949-88119971 AGCAAAAGGACAGAGGAGGAGGG No data
1071718419_1071718424 13 Left 1071718419 10:88119899-88119921 CCAGGGCATCTTGAAGCGGTAGG No data
Right 1071718424 10:88119935-88119957 AGGTAGACTAGGACAGCAAAAGG No data
1071718419_1071718427 26 Left 1071718419 10:88119899-88119921 CCAGGGCATCTTGAAGCGGTAGG No data
Right 1071718427 10:88119948-88119970 CAGCAAAAGGACAGAGGAGGAGG No data
1071718419_1071718422 -7 Left 1071718419 10:88119899-88119921 CCAGGGCATCTTGAAGCGGTAGG No data
Right 1071718422 10:88119915-88119937 CGGTAGGACAAGAACAGGAAAGG No data
1071718419_1071718426 23 Left 1071718419 10:88119899-88119921 CCAGGGCATCTTGAAGCGGTAGG No data
Right 1071718426 10:88119945-88119967 GGACAGCAAAAGGACAGAGGAGG No data
1071718419_1071718425 20 Left 1071718419 10:88119899-88119921 CCAGGGCATCTTGAAGCGGTAGG No data
Right 1071718425 10:88119942-88119964 CTAGGACAGCAAAAGGACAGAGG No data
1071718419_1071718423 2 Left 1071718419 10:88119899-88119921 CCAGGGCATCTTGAAGCGGTAGG No data
Right 1071718423 10:88119924-88119946 AAGAACAGGAAAGGTAGACTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071718419 Original CRISPR CCTACCGCTTCAAGATGCCC TGG (reversed) Intergenic
No off target data available for this crispr