ID: 1071718421

View in Genome Browser
Species Human (GRCh38)
Location 10:88119910-88119932
Sequence TGAAGCGGTAGGACAAGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071718415_1071718421 -7 Left 1071718415 10:88119894-88119916 CCCCACCAGGGCATCTTGAAGCG No data
Right 1071718421 10:88119910-88119932 TGAAGCGGTAGGACAAGAACAGG No data
1071718416_1071718421 -8 Left 1071718416 10:88119895-88119917 CCCACCAGGGCATCTTGAAGCGG No data
Right 1071718421 10:88119910-88119932 TGAAGCGGTAGGACAAGAACAGG No data
1071718418_1071718421 -9 Left 1071718418 10:88119896-88119918 CCACCAGGGCATCTTGAAGCGGT No data
Right 1071718421 10:88119910-88119932 TGAAGCGGTAGGACAAGAACAGG No data
1071718412_1071718421 17 Left 1071718412 10:88119870-88119892 CCAGAAACAGAGAAATCAGAAAG No data
Right 1071718421 10:88119910-88119932 TGAAGCGGTAGGACAAGAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071718421 Original CRISPR TGAAGCGGTAGGACAAGAAC AGG Intergenic
No off target data available for this crispr