ID: 1071718427

View in Genome Browser
Species Human (GRCh38)
Location 10:88119948-88119970
Sequence CAGCAAAAGGACAGAGGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071718416_1071718427 30 Left 1071718416 10:88119895-88119917 CCCACCAGGGCATCTTGAAGCGG No data
Right 1071718427 10:88119948-88119970 CAGCAAAAGGACAGAGGAGGAGG No data
1071718418_1071718427 29 Left 1071718418 10:88119896-88119918 CCACCAGGGCATCTTGAAGCGGT No data
Right 1071718427 10:88119948-88119970 CAGCAAAAGGACAGAGGAGGAGG No data
1071718419_1071718427 26 Left 1071718419 10:88119899-88119921 CCAGGGCATCTTGAAGCGGTAGG No data
Right 1071718427 10:88119948-88119970 CAGCAAAAGGACAGAGGAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071718427 Original CRISPR CAGCAAAAGGACAGAGGAGG AGG Intergenic
No off target data available for this crispr