ID: 1071719019

View in Genome Browser
Species Human (GRCh38)
Location 10:88124014-88124036
Sequence GCCCATCCTCATATTGTCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071719019_1071719031 25 Left 1071719019 10:88124014-88124036 CCCATGACAATATGAGGATGGGC No data
Right 1071719031 10:88124062-88124084 GGACCAAACAGATGGAGTATGGG No data
1071719019_1071719025 -9 Left 1071719019 10:88124014-88124036 CCCATGACAATATGAGGATGGGC No data
Right 1071719025 10:88124028-88124050 AGGATGGGCCTGATAGGGTGGGG No data
1071719019_1071719024 -10 Left 1071719019 10:88124014-88124036 CCCATGACAATATGAGGATGGGC No data
Right 1071719024 10:88124027-88124049 GAGGATGGGCCTGATAGGGTGGG No data
1071719019_1071719029 17 Left 1071719019 10:88124014-88124036 CCCATGACAATATGAGGATGGGC No data
Right 1071719029 10:88124054-88124076 GAGCTTGTGGACCAAACAGATGG No data
1071719019_1071719030 24 Left 1071719019 10:88124014-88124036 CCCATGACAATATGAGGATGGGC No data
Right 1071719030 10:88124061-88124083 TGGACCAAACAGATGGAGTATGG No data
1071719019_1071719027 4 Left 1071719019 10:88124014-88124036 CCCATGACAATATGAGGATGGGC No data
Right 1071719027 10:88124041-88124063 TAGGGTGGGGACCGAGCTTGTGG No data
1071719019_1071719032 26 Left 1071719019 10:88124014-88124036 CCCATGACAATATGAGGATGGGC No data
Right 1071719032 10:88124063-88124085 GACCAAACAGATGGAGTATGGGG No data
1071719019_1071719034 30 Left 1071719019 10:88124014-88124036 CCCATGACAATATGAGGATGGGC No data
Right 1071719034 10:88124067-88124089 AAACAGATGGAGTATGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071719019 Original CRISPR GCCCATCCTCATATTGTCAT GGG (reversed) Intergenic
No off target data available for this crispr