ID: 1071719026

View in Genome Browser
Species Human (GRCh38)
Location 10:88124036-88124058
Sequence AGCTCGGTCCCCACCCTATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071719026_1071719034 8 Left 1071719026 10:88124036-88124058 CCTGATAGGGTGGGGACCGAGCT No data
Right 1071719034 10:88124067-88124089 AAACAGATGGAGTATGGGGCAGG No data
1071719026_1071719032 4 Left 1071719026 10:88124036-88124058 CCTGATAGGGTGGGGACCGAGCT No data
Right 1071719032 10:88124063-88124085 GACCAAACAGATGGAGTATGGGG No data
1071719026_1071719030 2 Left 1071719026 10:88124036-88124058 CCTGATAGGGTGGGGACCGAGCT No data
Right 1071719030 10:88124061-88124083 TGGACCAAACAGATGGAGTATGG No data
1071719026_1071719029 -5 Left 1071719026 10:88124036-88124058 CCTGATAGGGTGGGGACCGAGCT No data
Right 1071719029 10:88124054-88124076 GAGCTTGTGGACCAAACAGATGG No data
1071719026_1071719036 19 Left 1071719026 10:88124036-88124058 CCTGATAGGGTGGGGACCGAGCT No data
Right 1071719036 10:88124078-88124100 GTATGGGGCAGGTGGACACAAGG No data
1071719026_1071719035 11 Left 1071719026 10:88124036-88124058 CCTGATAGGGTGGGGACCGAGCT No data
Right 1071719035 10:88124070-88124092 CAGATGGAGTATGGGGCAGGTGG No data
1071719026_1071719031 3 Left 1071719026 10:88124036-88124058 CCTGATAGGGTGGGGACCGAGCT No data
Right 1071719031 10:88124062-88124084 GGACCAAACAGATGGAGTATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071719026 Original CRISPR AGCTCGGTCCCCACCCTATC AGG (reversed) Intergenic
No off target data available for this crispr