ID: 1071719030

View in Genome Browser
Species Human (GRCh38)
Location 10:88124061-88124083
Sequence TGGACCAAACAGATGGAGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071719020_1071719030 23 Left 1071719020 10:88124015-88124037 CCATGACAATATGAGGATGGGCC No data
Right 1071719030 10:88124061-88124083 TGGACCAAACAGATGGAGTATGG No data
1071719016_1071719030 28 Left 1071719016 10:88124010-88124032 CCAGCCCATGACAATATGAGGAT No data
Right 1071719030 10:88124061-88124083 TGGACCAAACAGATGGAGTATGG No data
1071719019_1071719030 24 Left 1071719019 10:88124014-88124036 CCCATGACAATATGAGGATGGGC No data
Right 1071719030 10:88124061-88124083 TGGACCAAACAGATGGAGTATGG No data
1071719026_1071719030 2 Left 1071719026 10:88124036-88124058 CCTGATAGGGTGGGGACCGAGCT No data
Right 1071719030 10:88124061-88124083 TGGACCAAACAGATGGAGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071719030 Original CRISPR TGGACCAAACAGATGGAGTA TGG Intergenic
No off target data available for this crispr