ID: 1071721238

View in Genome Browser
Species Human (GRCh38)
Location 10:88148535-88148557
Sequence GTCTCACGGTTCCACGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071721233_1071721238 15 Left 1071721233 10:88148497-88148519 CCGAGACTGGGCAATTTACAAAT No data
Right 1071721238 10:88148535-88148557 GTCTCACGGTTCCACGTGGCTGG No data
1071721232_1071721238 16 Left 1071721232 10:88148496-88148518 CCCGAGACTGGGCAATTTACAAA 0: 1218
1: 2582
2: 9465
3: 14662
4: 12792
Right 1071721238 10:88148535-88148557 GTCTCACGGTTCCACGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071721238 Original CRISPR GTCTCACGGTTCCACGTGGC TGG Intergenic
No off target data available for this crispr