ID: 1071722103

View in Genome Browser
Species Human (GRCh38)
Location 10:88157489-88157511
Sequence GCTGCTTTTCCTGACAATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071722098_1071722103 21 Left 1071722098 10:88157445-88157467 CCTTTCCAGGCCACAGTGAACTT No data
Right 1071722103 10:88157489-88157511 GCTGCTTTTCCTGACAATGCTGG No data
1071722100_1071722103 11 Left 1071722100 10:88157455-88157477 CCACAGTGAACTTCATGACCTCC No data
Right 1071722103 10:88157489-88157511 GCTGCTTTTCCTGACAATGCTGG No data
1071722102_1071722103 -10 Left 1071722102 10:88157476-88157498 CCGAGTCTCTTGTGCTGCTTTTC No data
Right 1071722103 10:88157489-88157511 GCTGCTTTTCCTGACAATGCTGG No data
1071722101_1071722103 -7 Left 1071722101 10:88157473-88157495 CCTCCGAGTCTCTTGTGCTGCTT No data
Right 1071722103 10:88157489-88157511 GCTGCTTTTCCTGACAATGCTGG No data
1071722096_1071722103 23 Left 1071722096 10:88157443-88157465 CCCCTTTCCAGGCCACAGTGAAC No data
Right 1071722103 10:88157489-88157511 GCTGCTTTTCCTGACAATGCTGG No data
1071722097_1071722103 22 Left 1071722097 10:88157444-88157466 CCCTTTCCAGGCCACAGTGAACT No data
Right 1071722103 10:88157489-88157511 GCTGCTTTTCCTGACAATGCTGG No data
1071722099_1071722103 16 Left 1071722099 10:88157450-88157472 CCAGGCCACAGTGAACTTCATGA No data
Right 1071722103 10:88157489-88157511 GCTGCTTTTCCTGACAATGCTGG No data
1071722095_1071722103 24 Left 1071722095 10:88157442-88157464 CCCCCTTTCCAGGCCACAGTGAA No data
Right 1071722103 10:88157489-88157511 GCTGCTTTTCCTGACAATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071722103 Original CRISPR GCTGCTTTTCCTGACAATGC TGG Intergenic
No off target data available for this crispr