ID: 1071724826 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 10:88187622-88187644 |
Sequence | CAGCTGTCCTGGAGGACAAG TGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1071724821_1071724826 | 18 | Left | 1071724821 | 10:88187581-88187603 | CCAAGATTCACAGCAATAAGATT | No data | ||
Right | 1071724826 | 10:88187622-88187644 | CAGCTGTCCTGGAGGACAAGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1071724826 | Original CRISPR | CAGCTGTCCTGGAGGACAAG TGG | Intergenic | ||
No off target data available for this crispr |