ID: 1071724826

View in Genome Browser
Species Human (GRCh38)
Location 10:88187622-88187644
Sequence CAGCTGTCCTGGAGGACAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071724821_1071724826 18 Left 1071724821 10:88187581-88187603 CCAAGATTCACAGCAATAAGATT No data
Right 1071724826 10:88187622-88187644 CAGCTGTCCTGGAGGACAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071724826 Original CRISPR CAGCTGTCCTGGAGGACAAG TGG Intergenic
No off target data available for this crispr