ID: 1071726954

View in Genome Browser
Species Human (GRCh38)
Location 10:88208476-88208498
Sequence TTGTAACTACAGTGGCTCTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071726954_1071726957 -9 Left 1071726954 10:88208476-88208498 CCCTAGAGCCACTGTAGTTACAA No data
Right 1071726957 10:88208490-88208512 TAGTTACAATAATGTAGTATTGG No data
1071726954_1071726958 7 Left 1071726954 10:88208476-88208498 CCCTAGAGCCACTGTAGTTACAA No data
Right 1071726958 10:88208506-88208528 GTATTGGCATAAAATACCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071726954 Original CRISPR TTGTAACTACAGTGGCTCTA GGG (reversed) Intergenic
No off target data available for this crispr