ID: 1071728115

View in Genome Browser
Species Human (GRCh38)
Location 10:88219914-88219936
Sequence CCTTCAGGGGAATCTCCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071728102_1071728115 7 Left 1071728102 10:88219884-88219906 CCTTTGCCCCCTTCTGGGATCTG No data
Right 1071728115 10:88219914-88219936 CCTTCAGGGGAATCTCCTCTGGG No data
1071728095_1071728115 24 Left 1071728095 10:88219867-88219889 CCCCCTGCTCCTGAGCTCCTTTG No data
Right 1071728115 10:88219914-88219936 CCTTCAGGGGAATCTCCTCTGGG No data
1071728103_1071728115 1 Left 1071728103 10:88219890-88219912 CCCCCTTCTGGGATCTGAGCCCA No data
Right 1071728115 10:88219914-88219936 CCTTCAGGGGAATCTCCTCTGGG No data
1071728104_1071728115 0 Left 1071728104 10:88219891-88219913 CCCCTTCTGGGATCTGAGCCCAC No data
Right 1071728115 10:88219914-88219936 CCTTCAGGGGAATCTCCTCTGGG No data
1071728106_1071728115 -2 Left 1071728106 10:88219893-88219915 CCTTCTGGGATCTGAGCCCACCC No data
Right 1071728115 10:88219914-88219936 CCTTCAGGGGAATCTCCTCTGGG No data
1071728097_1071728115 22 Left 1071728097 10:88219869-88219891 CCCTGCTCCTGAGCTCCTTTGCC No data
Right 1071728115 10:88219914-88219936 CCTTCAGGGGAATCTCCTCTGGG No data
1071728099_1071728115 15 Left 1071728099 10:88219876-88219898 CCTGAGCTCCTTTGCCCCCTTCT No data
Right 1071728115 10:88219914-88219936 CCTTCAGGGGAATCTCCTCTGGG No data
1071728098_1071728115 21 Left 1071728098 10:88219870-88219892 CCTGCTCCTGAGCTCCTTTGCCC No data
Right 1071728115 10:88219914-88219936 CCTTCAGGGGAATCTCCTCTGGG No data
1071728105_1071728115 -1 Left 1071728105 10:88219892-88219914 CCCTTCTGGGATCTGAGCCCACC No data
Right 1071728115 10:88219914-88219936 CCTTCAGGGGAATCTCCTCTGGG No data
1071728096_1071728115 23 Left 1071728096 10:88219868-88219890 CCCCTGCTCCTGAGCTCCTTTGC No data
Right 1071728115 10:88219914-88219936 CCTTCAGGGGAATCTCCTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071728115 Original CRISPR CCTTCAGGGGAATCTCCTCT GGG Intergenic
No off target data available for this crispr