ID: 1071730133

View in Genome Browser
Species Human (GRCh38)
Location 10:88239663-88239685
Sequence CCTTTCTTTCCCAGGCTGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071730127_1071730133 -3 Left 1071730127 10:88239643-88239665 CCTTCCACATTCTGTAGTGTCCT No data
Right 1071730133 10:88239663-88239685 CCTTTCTTTCCCAGGCTGGGTGG No data
1071730128_1071730133 -7 Left 1071730128 10:88239647-88239669 CCACATTCTGTAGTGTCCTTTCT No data
Right 1071730133 10:88239663-88239685 CCTTTCTTTCCCAGGCTGGGTGG No data
1071730126_1071730133 12 Left 1071730126 10:88239628-88239650 CCACTTTGGTAGTGGCCTTCCAC No data
Right 1071730133 10:88239663-88239685 CCTTTCTTTCCCAGGCTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071730133 Original CRISPR CCTTTCTTTCCCAGGCTGGG TGG Intergenic
No off target data available for this crispr