ID: 1071730459

View in Genome Browser
Species Human (GRCh38)
Location 10:88243526-88243548
Sequence GTGCTGAGCAGACAGAAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071730459_1071730462 9 Left 1071730459 10:88243526-88243548 CCTCCTTTCTGTCTGCTCAGCAC No data
Right 1071730462 10:88243558-88243580 AACATTCGTTACCAAAAATCAGG No data
1071730459_1071730463 10 Left 1071730459 10:88243526-88243548 CCTCCTTTCTGTCTGCTCAGCAC No data
Right 1071730463 10:88243559-88243581 ACATTCGTTACCAAAAATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071730459 Original CRISPR GTGCTGAGCAGACAGAAAGG AGG (reversed) Intergenic
No off target data available for this crispr