ID: 1071733920

View in Genome Browser
Species Human (GRCh38)
Location 10:88276951-88276973
Sequence TAGGATCCAGAATTTATGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 152}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071733920 Original CRISPR TAGGATCCAGAATTTATGCA AGG (reversed) Intronic
902899698 1:19506288-19506310 TAGAAACCAGAATTTGTGCTAGG + Intergenic
906555729 1:46711471-46711493 CAGGATCCAGAATATTTTCAGGG - Intronic
906640990 1:47440229-47440251 TGGGATCCAGGGTTTCTGCAGGG - Exonic
908161710 1:61415354-61415376 AAGTATCCAAAATTTATGCATGG + Intronic
909205014 1:72744798-72744820 TATGTGCCAGAACTTATGCAAGG + Intergenic
914513531 1:148354414-148354436 TAGGAGCTAGAAATTAGGCATGG - Intergenic
915007469 1:152652840-152652862 AAGAATCCAGATTTTAAGCATGG - Intergenic
917605837 1:176628219-176628241 GAGGGTTCAGAATGTATGCAAGG + Intronic
919865106 1:201775612-201775634 TTGGAACCAGAAACTATGCAAGG + Intronic
920686655 1:208114034-208114056 GAGGATTCAGAATTTATGTTTGG + Intronic
920823296 1:209401380-209401402 TAGGATGCAGATTTTATGATGGG - Intergenic
1066666059 10:37783711-37783733 TGAGATCCAGAGTTTATGGATGG + Intronic
1069726895 10:70585955-70585977 TGAGATCAAGCATTTATGCAGGG + Intergenic
1070720835 10:78755907-78755929 TGGGTTCCAGAATTCATGGATGG + Intergenic
1070869440 10:79737360-79737382 TAGAAACCAGAAGTTATTCATGG - Intergenic
1071191301 10:83104634-83104656 AATGATCCATAATTTATGCCTGG + Intergenic
1071636358 10:87259566-87259588 TAGAAACCAGAAGTTATTCATGG - Intergenic
1071658883 10:87478385-87478407 TAGAAACCAGAAGTTATTCATGG + Intergenic
1071733920 10:88276951-88276973 TAGGATCCAGAATTTATGCAAGG - Intronic
1078635559 11:13046545-13046567 TAGGATCCAGAATGTAGGGAGGG - Intergenic
1079648603 11:22897904-22897926 TAGAATCCAGAATTTTCACAAGG - Intergenic
1086225936 11:84509195-84509217 CAGAATTCAGACTTTATGCAAGG - Intronic
1086484989 11:87289989-87290011 TAATATCCAGAATATATCCATGG - Intronic
1086594415 11:88553969-88553991 TGGGATCCAGATCTTATGAAGGG + Intronic
1088520429 11:110692338-110692360 TATGTTCCAGATTTTTTGCAGGG + Intronic
1092796795 12:12119267-12119289 AAGGATTCAGAATTTGGGCAAGG - Exonic
1093808048 12:23458921-23458943 TAGGCTCCAGAATTTTTGTAGGG + Intergenic
1094098211 12:26731832-26731854 TAGAATTCAGAGTTGATGCAGGG + Intronic
1094253762 12:28398183-28398205 CAGGATCCAGAGTTTATAGAAGG - Intronic
1095869598 12:47011667-47011689 TAGGATTCAGAGTTTTTGGAAGG + Intergenic
1096977090 12:55705607-55705629 TTGGATCCAGAATCTCTGTAAGG + Intronic
1100007407 12:89910876-89910898 TAGGAAACAGAAATGATGCAGGG - Intergenic
1101475365 12:105041590-105041612 TATTATCCAGAAATTATCCATGG - Intronic
1105363086 13:19739110-19739132 TAGCTTACAGAATTTATGTATGG + Intronic
1107000168 13:35534785-35534807 TAGGATCCAGATATTGTGCTAGG - Intronic
1110771511 13:79353687-79353709 TAAGATGCTGAATTTCTGCAAGG - Intronic
1110823631 13:79945923-79945945 CCTGATCCTGAATTTATGCAGGG + Intergenic
1111136521 13:84052478-84052500 TAGAACACAGAGTTTATGCATGG - Intergenic
1112133433 13:96549286-96549308 TAGGATCCATGATTTATGTGTGG + Intronic
1114748894 14:25181670-25181692 AAGTATCCAGAATTAATGAAAGG - Intergenic
1115876781 14:37869934-37869956 TGGGATCCAGAATTTCCCCAGGG - Intronic
1116327559 14:43550544-43550566 TTGTATCCAGGATTTATACAAGG + Intergenic
1117100924 14:52346241-52346263 TAGTATCCAGAATATATAAAGGG + Intergenic
1117851689 14:59979089-59979111 TAAAATCCAGAATGTATGTAAGG - Intronic
1121845215 14:97166562-97166584 AAGGCTCCAGAATTTCTACATGG - Intergenic
1122680635 14:103459284-103459306 AAGGCTTCAGAATTTCTGCAGGG - Intronic
1126651699 15:50929558-50929580 TATGATACAGAATTAATACATGG - Intronic
1126863457 15:52911252-52911274 TATGATCCAGCAATTATGCTTGG + Intergenic
1127528696 15:59820186-59820208 TAGGATCCCAGATTTATGCAAGG - Intergenic
1130399094 15:83532531-83532553 TAGGAGCCTGAATTTATCCTGGG + Intronic
1132663637 16:1072281-1072303 TAGGATCCACAAATAAGGCATGG + Intergenic
1133364437 16:5199573-5199595 GAGGATACAGAATTTAACCAAGG + Intergenic
1136528231 16:30847254-30847276 TAGGATCCAGAAATTTGGAATGG + Intronic
1144653036 17:17018983-17019005 TAGATTCCAGAATTCATTCATGG + Intergenic
1145291279 17:21548331-21548353 TGGGATCCAGAATCTTTGCATGG + Intronic
1149100543 17:52901160-52901182 TAGAAGCCAGAATTTACACAAGG - Intergenic
1149757723 17:59201469-59201491 CAGAACCCAGAATTTTTGCATGG - Intronic
1153142267 18:1986660-1986682 TATGATTCAGAATATAGGCATGG + Intergenic
1154164556 18:12004818-12004840 TAGAATCCACAATATAGGCAGGG - Intronic
1161517325 19:4703748-4703770 TAGGCTACAGAAGGTATGCACGG + Intronic
1165537881 19:36465017-36465039 GAGTATCTAGAATTTATACAAGG + Intronic
1168058232 19:53875429-53875451 TTGGCTCCAGAATTTTTGCCAGG + Exonic
926392867 2:12412001-12412023 CAGGAACCAGAAATTATGAAAGG + Intergenic
927335243 2:21915016-21915038 TAGCTTCCAGAGTTTATGTATGG + Intergenic
928749561 2:34456412-34456434 TCAGTTCCAGAATTTATGCTTGG + Intergenic
929930719 2:46253611-46253633 TAGAAGCCAGACTTTATCCAGGG + Intergenic
931405348 2:61971724-61971746 TAAGATCAAGAATAAATGCAGGG - Intronic
931416551 2:62086742-62086764 TAGGATCCAGAACTTATTTTGGG + Intronic
933056863 2:77681230-77681252 GAGGATCAGGAATTCATGCATGG - Intergenic
934720409 2:96571321-96571343 AAGAATCCACAATTTAGGCAAGG - Intergenic
934844689 2:97655269-97655291 AAGGATCCAGAGGTTATCCAGGG - Intergenic
935563722 2:104584830-104584852 AAGGATCTAGAAGTTGTGCAGGG + Intergenic
935607463 2:104985146-104985168 TAGAATCCATATTTTATTCAGGG - Intergenic
936780518 2:116027347-116027369 TAGGATGGAGAATGTATGGAAGG + Intergenic
940475460 2:154156786-154156808 TAAGTTCCAGACTTTATTCAAGG - Intronic
941424652 2:165327119-165327141 TAGAATCCATGAGTTATGCACGG - Intronic
941499903 2:166261240-166261262 GAGAATCCAGATTTTATTCAGGG + Intronic
941800623 2:169655940-169655962 CAGGACCCAGATTTTATTCAGGG + Intronic
947338635 2:229113730-229113752 TAAGAACCAGAATTTAAACATGG - Intronic
1168777085 20:456904-456926 AAGGATCCAGAATATATTCTTGG - Intronic
1170574286 20:17650741-17650763 TAGGATCCAGACTTGATTCCAGG + Intronic
1171326434 20:24297739-24297761 TGGGACCCTGACTTTATGCAGGG - Intergenic
1173306926 20:41859665-41859687 TCTGGTCCAGAATTTATTCAGGG + Intergenic
1174252690 20:49231251-49231273 TAGGATACAGTATTCATGAAGGG + Intronic
1184815601 22:46866755-46866777 TAGGATCCTGAATTCCTGAAGGG - Intronic
949701355 3:6762948-6762970 GAGGATGCAAAATATATGCAGGG + Intergenic
955411678 3:58659521-58659543 CAGGAGCCAGGATTTAAGCAGGG - Intronic
955421999 3:58748262-58748284 TAGGAGCCTGATTTTAAGCAAGG + Intronic
955847950 3:63187279-63187301 TAATATCCAGAATATATGCAAGG - Intergenic
960180232 3:114567357-114567379 TAGGAAACGGCATTTATGCATGG - Intronic
961948294 3:130717630-130717652 TAGTTTCCAGAGTTTATCCAAGG + Intronic
963167280 3:142217908-142217930 TAGATTCTAAAATTTATGCAAGG + Intronic
964992424 3:162829804-162829826 TAGGATTCTGAATTTATTCTGGG - Intergenic
965157274 3:165079349-165079371 TAGTATCCAGATGGTATGCAAGG - Intergenic
965689920 3:171344813-171344835 TAGGATCTATAATTTTGGCAAGG - Intronic
965972454 3:174577683-174577705 TAGAATCCAGAGTTTTTGCCAGG + Intronic
966788521 3:183642195-183642217 TAAGATCCTGAATCAATGCAGGG - Intronic
967597780 3:191348005-191348027 CAGGATCTAGAATATATGCTGGG + Intronic
968017784 3:195354743-195354765 TAGTATCCAGGATATATGTATGG - Intronic
970466438 4:16328013-16328035 CAGTATTCAGAACTTATGCAGGG + Intergenic
972257131 4:37369173-37369195 TATGATCCAAAATTTATGAAAGG + Intronic
972388546 4:38591136-38591158 ATGGATCAAGAATTTAGGCAAGG + Intergenic
973019406 4:45183170-45183192 TGGGAGTCTGAATTTATGCAGGG - Intergenic
975200216 4:71578766-71578788 TAAAATCCAAAATTTATGAAGGG + Intergenic
976670335 4:87645373-87645395 TAGGCTCCAGGATTTATACCAGG - Intergenic
976997137 4:91448589-91448611 AAGGACCCTGAATTTTTGCATGG - Intronic
977575859 4:98673618-98673640 TAGGATTGAGAATTTCTGCCTGG + Intergenic
978872770 4:113600267-113600289 TAGAGTCCATAATTTATGCTAGG - Intronic
982468320 4:155758770-155758792 TCTGCTCCAGAATTCATGCAAGG + Intergenic
985948433 5:3204386-3204408 TAGGATCCAGACTCCATGCTAGG - Intergenic
986376798 5:7140749-7140771 AATGATCCAGGATTTCTGCAGGG + Intergenic
986973378 5:13364324-13364346 TAGGATCTACCATATATGCAAGG + Intergenic
987897644 5:23968601-23968623 TATGAGCAAGAATTTATGTATGG - Intronic
991546476 5:67787520-67787542 CAGGATCCAGAATTTATATCGGG + Intergenic
992089656 5:73305665-73305687 TAAGCTGCAGAATTTAAGCAAGG + Intergenic
994328697 5:98480650-98480672 AAAGAGACAGAATTTATGCAGGG + Intergenic
994504075 5:100617845-100617867 TAGGACCCAGAATTTAGTCTAGG + Intergenic
994766191 5:103921109-103921131 GAGGAAACAGAATTTATTCAAGG + Intergenic
995672901 5:114626924-114626946 TAGGATCCAGTACTGCTGCACGG - Intergenic
996685392 5:126274304-126274326 TGGTATTCAGAATTTCTGCAAGG - Intergenic
997806120 5:136919878-136919900 TAGGAGGCTGTATTTATGCATGG + Intergenic
998321074 5:141232334-141232356 TTGGACCCAGAATTGTTGCAAGG - Intergenic
1001849258 5:174949562-174949584 AAGAATCCAGCATTCATGCATGG + Intergenic
1007194167 6:40045997-40046019 TAATATCCAGAATATATGCCAGG + Intergenic
1009373873 6:62943208-62943230 TAAGATCCAAAATTAATTCACGG - Intergenic
1009621255 6:66080644-66080666 TAATATCCAGAATCTATACAAGG - Intergenic
1009870410 6:69446095-69446117 TAGCAACTAGAATTTTTGCAAGG - Intergenic
1010395529 6:75387759-75387781 TAATATCCAGAATCTATCCAAGG - Intronic
1012552167 6:100473576-100473598 TAAGATCCAGAAGCTATGGAAGG - Intergenic
1012750279 6:103152727-103152749 TAGAATCCAGAAGTGATGCCAGG - Intergenic
1015943937 6:138480351-138480373 CAGGACCCAGAATGTATGGAGGG + Intronic
1016865650 6:148763387-148763409 TAATATCCAGAATCTATACAAGG - Intronic
1018524153 6:164689082-164689104 TTATATCCAGAAATTATGCATGG + Intergenic
1020681587 7:11243850-11243872 TAATATCCACAATTTCTGCAAGG - Intergenic
1022357213 7:29627455-29627477 TGGGATACAGAATTTAAGCCTGG + Intergenic
1022864172 7:34400050-34400072 AGGGATCCAGAATTTGGGCAGGG + Intergenic
1028531718 7:91845673-91845695 TAGGATCCTGAATATGGGCAAGG + Intronic
1030571861 7:111236507-111236529 TAGTTTTCAGAATTTATACAGGG - Intronic
1042861257 8:73316392-73316414 TAGGCTCTATAATTTATACATGG - Intronic
1043029372 8:75113371-75113393 TAGGATGCAAAATGTATGCAGGG - Intergenic
1043649478 8:82572721-82572743 TAGAATACAGATTTTGTGCATGG - Intergenic
1044446064 8:92277453-92277475 ATGGATCCAGAATTTGTGCAGGG - Intergenic
1045458568 8:102406820-102406842 TAGGAGCCAGAAAATATGCCAGG - Intronic
1045613209 8:103872858-103872880 TAGAATCCAAATTTTATTCAGGG - Intronic
1045615193 8:103900837-103900859 TTAGATCCAGAAACTATGCAAGG + Intronic
1045915223 8:107461710-107461732 TAGCATCCAGAATTTGTTAATGG - Intronic
1050443712 9:5695243-5695265 TAGGACCTAAAATTTATTCACGG - Intronic
1050798798 9:9582343-9582365 TAGAATGCAGAATTAATGCCTGG + Intronic
1055533115 9:77207609-77207631 TAGGATCCAAATTTTGTACATGG - Intronic
1056667153 9:88589934-88589956 CAGGCTCCAGAATCAATGCAAGG + Intergenic
1057894385 9:98895796-98895818 TAGGAATGAGAATATATGCAAGG - Intergenic
1059130439 9:111742329-111742351 GAGGATCCAGAATTTCTATATGG - Intronic
1059972583 9:119682769-119682791 TAGAATCCAGAATTTTTTCATGG - Intergenic
1185797962 X:2983023-2983045 TGGGATCCACACTTTATGCCTGG - Intergenic
1188240805 X:27786882-27786904 TAGGAGCCAGAACTTAAGAAGGG - Intergenic
1194389902 X:93303593-93303615 TATGAGCCAGAAATTATGCTAGG + Intergenic
1196384157 X:115129784-115129806 TAGCATGCAGAATTTGTGGAAGG + Intronic
1198329134 X:135605569-135605591 TTGGATGCAGAATTTATACTGGG - Intergenic
1198337407 X:135680006-135680028 TTGGATGCAGAATTTATACTGGG + Intergenic
1198361782 X:135902802-135902824 TTGGATGCAGAATTTATACTGGG - Intronic
1200732104 Y:6753329-6753351 GAAGATGCAGAATTTATCCATGG + Intergenic
1201669918 Y:16507832-16507854 TAGTAACCAGTATTTATGGATGG - Intergenic
1201746291 Y:17377546-17377568 TAGGAATCAGAATTTACTCAGGG + Intergenic