ID: 1071739430

View in Genome Browser
Species Human (GRCh38)
Location 10:88340219-88340241
Sequence TTCCTAAGGCACCCTGCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 137}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071739430_1071739432 6 Left 1071739430 10:88340219-88340241 CCTGCTGCAGGGTGCCTTAGGAA 0: 1
1: 0
2: 1
3: 14
4: 137
Right 1071739432 10:88340248-88340270 AACCAGAGAAGTTTTCCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071739430 Original CRISPR TTCCTAAGGCACCCTGCAGC AGG (reversed) Intronic
901585340 1:10285824-10285846 TTCCTAAGGCATGGTGCTGCAGG + Intronic
901636575 1:10673229-10673251 TTAATAAGCCACCCTGGAGCAGG + Intronic
902463886 1:16602631-16602653 TTCGTTAGGCCTCCTGCAGCTGG + Intronic
903157213 1:21454044-21454066 TTCGTTAGGCCTCCTGCAGCTGG - Intronic
903825914 1:26145741-26145763 TTCCTAGGGCAGCCTGTATCTGG - Intergenic
907464035 1:54623441-54623463 TCCCTGAGGCTCCCTGCAGCTGG + Exonic
912561141 1:110552372-110552394 TCCCTAAGTCACCCTCAAGCAGG + Intergenic
913992415 1:143627053-143627075 TTCGTTAGGCCTCCTGCAGCTGG + Intergenic
915590414 1:156867262-156867284 TTCCCAGGGCACCCTGCACAGGG + Intronic
916718102 1:167461959-167461981 TTCTTCAGGCACACAGCAGCAGG + Intronic
916785855 1:168086593-168086615 CTCCAAAGGCACCCTCCAGGTGG - Intronic
918942951 1:191026087-191026109 TGCCTAAGCCCCCCTGCAGTGGG - Intergenic
919838783 1:201594412-201594434 CTCCTAAGGCTCCCTCCCGCAGG - Intergenic
1062953022 10:1519517-1519539 TCCCTGAAGGACCCTGCAGCTGG + Intronic
1064087362 10:12355254-12355276 TTCCTAAAGCAGCATCCAGCAGG - Intronic
1069832782 10:71291301-71291323 TTCCCAAAGCTTCCTGCAGCTGG + Intronic
1071739430 10:88340219-88340241 TTCCTAAGGCACCCTGCAGCAGG - Intronic
1075123527 10:119681612-119681634 TTCCTCAGCCTCCATGCAGCCGG - Intergenic
1075574364 10:123568119-123568141 TTTCCAGGGCATCCTGCAGCGGG + Intergenic
1075946498 10:126437810-126437832 AGCCTCAGGGACCCTGCAGCTGG - Intronic
1076673705 10:132136849-132136871 TTCCCCAGGGACTCTGCAGCTGG + Intronic
1077035921 11:494413-494435 TGCCTAAGGGACCCCGCACCAGG - Intergenic
1077199732 11:1299951-1299973 TCCTTATGGCTCCCTGCAGCAGG - Intronic
1079398272 11:20084688-20084710 TTCCTTAGGCACTCTGCAGATGG - Intronic
1082961469 11:58922265-58922287 TTCCTAACGCACCATCCAACTGG - Intronic
1089437081 11:118478108-118478130 GTCCTCAGGCACCTGGCAGCCGG - Exonic
1091209597 11:133844850-133844872 TTCCTGAGACACCCTTGAGCTGG + Intronic
1091327235 11:134700522-134700544 TTCCTATGGCACCCTGTTCCTGG + Intergenic
1095925752 12:47577416-47577438 TTACTAAGCAACCCTGCTGCTGG + Intergenic
1096111257 12:49030651-49030673 TTCCAAAGGCCCCCCTCAGCTGG + Exonic
1103305698 12:119962379-119962401 TTCCTAGGGCAGCCTGCATCTGG - Intergenic
1113801168 13:113087103-113087125 TTCCTGGGACGCCCTGCAGCTGG + Intronic
1117144164 14:52820245-52820267 TGCCTAAAGCAACCTGCTGCAGG - Intergenic
1118013196 14:61631137-61631159 TGACTAAGGCACCATGTAGCTGG - Intronic
1118853206 14:69600710-69600732 GTCCTTAGGCCCACTGCAGCAGG - Intergenic
1128081142 15:64857615-64857637 CTCCTAAGGAACCCTGTATCTGG - Intronic
1128361239 15:66963263-66963285 TTCCTGGGGCAGCCTACAGCTGG + Intergenic
1130150467 15:81307708-81307730 TTCCAACATCACCCTGCAGCTGG - Intronic
1134228646 16:12412036-12412058 TTCCTAAGGTACCTGGCACCTGG + Intronic
1137978224 16:53048781-53048803 AACCCAAGGCACCCTGCAGAAGG + Intergenic
1138338322 16:56270026-56270048 TGCCTTAGGGACCCTGCAGGAGG - Intronic
1139967880 16:70755715-70755737 TTCCTAAAGAAAGCTGCAGCGGG + Intronic
1140664285 16:77213533-77213555 ATCCAAAGGCACCCAGCAGCAGG + Intergenic
1141675596 16:85515684-85515706 CTTCCAGGGCACCCTGCAGCTGG + Intergenic
1148343821 17:46890302-46890324 CTCCTGAAGCACCCTCCAGCTGG - Intergenic
1150740122 17:67772589-67772611 TTCCTCAGCCTCCCTGTAGCTGG - Intergenic
1152270776 17:79323613-79323635 TCCCCAAGCCTCCCTGCAGCGGG + Intronic
1159625632 18:70690762-70690784 TTCTTAATACACTCTGCAGCAGG + Intergenic
1162704919 19:12548329-12548351 TGCCTCAGCCACCCAGCAGCTGG + Intronic
1163687801 19:18722004-18722026 TACCTAGGTCACCGTGCAGCCGG + Intronic
1165015424 19:32876736-32876758 TTCCTATGGCACCCAGCAGGAGG + Intergenic
1202679545 1_KI270711v1_random:40071-40093 TTCGTTAGGCCTCCTGCAGCTGG + Intergenic
925140384 2:1546185-1546207 TTCCCAAGTCACCCAGCAGGTGG - Intergenic
925267672 2:2578167-2578189 TTCACAGGGCACCCAGCAGCAGG - Intergenic
926035753 2:9634232-9634254 GTTCTAAGGCTCCTTGCAGCAGG - Intergenic
926701229 2:15805147-15805169 GTTCTCAGGCACCCTGCGGCAGG + Intergenic
930698730 2:54438362-54438384 GCCCTAAGGCACCCTTCTGCCGG + Intergenic
931162871 2:59713330-59713352 TTTCTAAGGCAGACTACAGCAGG - Intergenic
932442885 2:71749010-71749032 TCCCTGAGACAGCCTGCAGCAGG - Intergenic
932619655 2:73258156-73258178 TTCCTGAGGGACCCTCCAGAGGG - Exonic
934121637 2:88845905-88845927 TTCCCAAGGCCCCGTGCACCTGG - Intergenic
934913078 2:98276803-98276825 TCCATAACGCACCCTGGAGCAGG - Intronic
935882677 2:107581554-107581576 TCTCAAATGCACCCTGCAGCAGG + Intergenic
937285102 2:120745771-120745793 GTCCTCATCCACCCTGCAGCTGG + Intronic
937369820 2:121289404-121289426 CTGCCAAGGCTCCCTGCAGCAGG + Intergenic
939070857 2:137540440-137540462 TTTCAAGGGTACCCTGCAGCTGG - Intronic
939865441 2:147467337-147467359 AACCTGAGGCACCCAGCAGCTGG - Intergenic
940256567 2:151737032-151737054 TTATTAGGGCAACCTGCAGCAGG - Intergenic
946169600 2:217886813-217886835 TACCTAGGGCTCCCAGCAGCAGG - Intronic
947879455 2:233493500-233493522 GTCCTGAGGGACCCTGAAGCTGG + Exonic
947989073 2:234472938-234472960 TTACTAAGGCACCCTGGCCCAGG + Intergenic
1169185438 20:3612519-3612541 TTCCAAATGCAGCCTACAGCAGG - Intronic
1169441324 20:5636192-5636214 GTCCTAAGGCCCACTGCACCCGG + Intergenic
1170605873 20:17874782-17874804 TTCCTAAGGAGACCTGCAGTTGG + Intergenic
1171749160 20:29030941-29030963 TGCCTCAGGCACCCAGCAGGTGG + Intergenic
1174347007 20:49937459-49937481 TTCTATAGCCACCCTGCAGCGGG + Intronic
1175033899 20:55981644-55981666 TTCCTAGGGCAACCTGCATTTGG + Intergenic
1175208536 20:57330245-57330267 TTCCAGAGGCTCCCTGCAGCTGG + Intronic
1175416623 20:58805404-58805426 CTCCTCAGGCACCCTGGGGCTGG + Intergenic
1176145476 20:63563487-63563509 CCCCTACGGCTCCCTGCAGCTGG - Exonic
1176316021 21:5244748-5244770 TGCCTCAGGCACCCAGCAGGTGG - Intergenic
1180393823 22:12310688-12310710 TGCCTCAGGCACCCAGCAGGTGG - Intergenic
1180405924 22:12554060-12554082 TGCCTCAGGCACCCAGCAGGTGG + Intergenic
1181672699 22:24433132-24433154 TGCCTCAGGAACCCTGAAGCTGG + Exonic
1182269046 22:29141957-29141979 TCCCTAAGGTCCCCTGAAGCAGG - Exonic
1183463508 22:37967401-37967423 TTGGTAAGGCCTCCTGCAGCAGG - Intronic
1184292090 22:43502798-43502820 CTCCTAATGGACCCTCCAGCAGG + Intronic
950280870 3:11706889-11706911 TTCCTAAGGCCACCCGCATCAGG - Intronic
950611146 3:14127410-14127432 TTCCTATTGCTGCCTGCAGCTGG + Intronic
953996360 3:47522920-47522942 TTCCTAAGGCAGCCTTCATCTGG + Intergenic
954320762 3:49830689-49830711 TTCCTGGGGAACCCAGCAGCTGG + Intronic
954755600 3:52837811-52837833 CTCGTAAGGCACCTTGGAGCAGG + Exonic
954902371 3:54030924-54030946 ATCCTTAGGCACCCTCCTGCTGG + Intergenic
956428862 3:69164570-69164592 AGCCTAGGGCAGCCTGCAGCTGG - Intergenic
957380120 3:79416861-79416883 TTCCTATGGCACTCTGCAAGTGG + Intronic
957810390 3:85214590-85214612 TTCCTAAGGTACCCTACTCCAGG - Intronic
959673340 3:109004824-109004846 TTCTTCAGGCACCCTTCAGTTGG + Exonic
960931198 3:122852724-122852746 TTACAAAGGCACCCCACAGCAGG + Intronic
962262936 3:133926584-133926606 TGCCTGAGGCACCTTGCAACTGG + Intergenic
962840009 3:139224725-139224747 TTCCTAATGCAGCCTGGGGCAGG + Intronic
966923879 3:184631941-184631963 TGCCTGTGGCACCCAGCAGCTGG - Intronic
968630243 4:1646796-1646818 TTCCTATGTGGCCCTGCAGCTGG - Intronic
969683607 4:8656800-8656822 TGCCTGGGGCTCCCTGCAGCTGG - Intergenic
972331007 4:38064553-38064575 TCCATCAGGGACCCTGCAGCTGG + Intronic
973889049 4:55351184-55351206 TGCCTAAGCCCCCCAGCAGCAGG + Intronic
976047134 4:80964205-80964227 TTCCTAATGTGCCCTGCAGGTGG + Intergenic
985431033 4:189880551-189880573 TGCCTCAGGCACCCAGCAGGCGG + Intergenic
985657127 5:1137978-1138000 TTCCTGAGTGACCCTGGAGCAGG + Intergenic
986187362 5:5457353-5457375 TTCCCCAGGCACTCTGGAGCTGG - Exonic
986333439 5:6734902-6734924 TGTCTAAGGCAGACTGCAGCAGG + Intronic
989156963 5:38353450-38353472 TTCCTAAGGCTCTCTGAAGCTGG + Intronic
990547716 5:56839778-56839800 TTGTTAATGCACCCTGCAACGGG + Intronic
991019701 5:61967303-61967325 TTCCTAAAGCATCCAGCAGATGG - Intergenic
997231866 5:132251377-132251399 TCCCTATGGCCCCCTGCACCTGG + Intronic
997521814 5:134527860-134527882 TGCCGAAGGCACACTGCGGCCGG + Intronic
998844628 5:146296110-146296132 TGCCTCAGCCACCCAGCAGCAGG + Intronic
1002388980 5:178894616-178894638 TTCCTAACGTCCCCTGAAGCAGG - Intergenic
1002801711 6:529259-529281 TTCCGAAGACACCTTGGAGCGGG + Intronic
1004672926 6:17814707-17814729 TTCCTATGGCATACTGCTGCTGG + Intronic
1006025319 6:31143119-31143141 TTCCCAGGCCACCTTGCAGCAGG - Exonic
1007175413 6:39893028-39893050 CTCCAAAGGCAGTCTGCAGCAGG - Intronic
1010132052 6:72505720-72505742 CTCCTGAGGCACCTAGCAGCTGG - Intergenic
1016541500 6:145170799-145170821 TTCCTAAAGCACCCTGTGCCGGG + Intergenic
1016652226 6:146475743-146475765 TTCCTAAGGACCCCAACAGCTGG - Intergenic
1017969480 6:159299343-159299365 TGCCTGAGGCTCACTGCAGCTGG - Intergenic
1018472184 6:164106796-164106818 TCCCAAAGGCACCGTGCACCAGG + Intergenic
1019075920 6:169388102-169388124 TCCCTGTGGCACCCTGTAGCCGG + Intergenic
1021359977 7:19700610-19700632 TCCCTAAGGAATCCTGCAGTGGG - Intronic
1024558477 7:50623651-50623673 TTCCCAAGATAGCCTGCAGCAGG - Intronic
1027421017 7:78018682-78018704 TTTCTAAGTCATCCTGCAGGAGG + Exonic
1027882692 7:83861515-83861537 TCCCCAAGACACCCTGCACCTGG - Intergenic
1029682337 7:102120154-102120176 TTGCTACTGCACCCTCCAGCAGG + Intronic
1031064219 7:117087022-117087044 TTCTTAATGCAGCTTGCAGCAGG + Intronic
1033503166 7:141974128-141974150 GTTTTGAGGCACCCTGCAGCAGG + Intronic
1034355732 7:150449582-150449604 TTCCAAAGGGACCCCGCAGAAGG - Intergenic
1035036406 7:155897985-155898007 TCCCTGAGGCTCCCTGCAGCTGG - Intergenic
1035240806 7:157527988-157528010 TTCCCAAGGTAGTCTGCAGCTGG + Intergenic
1035455534 7:159006398-159006420 TTCCTGAGGAAACCGGCAGCAGG - Intergenic
1035752175 8:2003364-2003386 TTCCTGAGGCAGCCTGCAGCCGG + Exonic
1038891220 8:31726722-31726744 ATCCTAAGGAGCCCTGGAGCTGG + Intronic
1047718074 8:127613974-127613996 TGCCTCAGCCACCCTGTAGCTGG - Intergenic
1047947676 8:129898198-129898220 TTTCCAAAGCACCCTGCAGAGGG + Intronic
1049707400 8:144049250-144049272 CTCCTCAGCCACCCTGCAGCTGG - Intergenic
1053720252 9:40938744-40938766 TGCCTCAGGCACCCAGCAGGTGG + Intergenic
1057039892 9:91840391-91840413 TTCCAAAGGCACCCTCCAGACGG + Intronic
1061542971 9:131288292-131288314 TTCCTAACTCACTCTGCAGCAGG + Intergenic
1062034029 9:134374853-134374875 TTCTTAAGGACTCCTGCAGCTGG + Intronic
1203454883 Un_GL000219v1:157087-157109 TGCCTCAGGCACCCAGCAGGTGG - Intergenic
1188779307 X:34260714-34260736 TTCCTAAAGCTTTCTGCAGCTGG - Intergenic
1190438191 X:50448811-50448833 TTCCTAGGGCATCCTGCAGGGGG - Intronic
1194904525 X:99558169-99558191 GTGCTAAGTCACTCTGCAGCTGG + Intergenic
1196064562 X:111448605-111448627 TACCTAAGGCAGAGTGCAGCAGG - Intergenic
1201686599 Y:16711440-16711462 TTCATAAGGCACCTTGCAACAGG - Intergenic