ID: 1071743537

View in Genome Browser
Species Human (GRCh38)
Location 10:88389293-88389315
Sequence GTCTCCTAACAGAACTGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071743532_1071743537 30 Left 1071743532 10:88389240-88389262 CCTAGGATTCAAAAAGCATTCAT 0: 1
1: 0
2: 1
3: 28
4: 263
Right 1071743537 10:88389293-88389315 GTCTCCTAACAGAACTGTGCTGG No data
1071743536_1071743537 -5 Left 1071743536 10:88389275-88389297 CCAGAAAAGGAGAGGTATGTCTC 0: 1
1: 0
2: 0
3: 4
4: 134
Right 1071743537 10:88389293-88389315 GTCTCCTAACAGAACTGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071743537 Original CRISPR GTCTCCTAACAGAACTGTGC TGG Intronic
No off target data available for this crispr