ID: 1071751804

View in Genome Browser
Species Human (GRCh38)
Location 10:88487298-88487320
Sequence GTTCAGGGGTGCATGTGTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 219
Summary {0: 1, 1: 0, 2: 2, 3: 13, 4: 203}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071751804 Original CRISPR GTTCAGGGGTGCATGTGTCA TGG (reversed) Intronic
900187851 1:1340743-1340765 GTGCAGGTGTGCATGTGTGCAGG - Intronic
900187853 1:1340777-1340799 GTGCAGGGGTGCGTGTGTGCAGG - Intronic
900187861 1:1340846-1340868 GCGCAGGGGTGCATGTGTGCAGG - Intronic
900187870 1:1340936-1340958 GTGCAGGGGTGCGTGTGTGCAGG - Intronic
900187883 1:1341030-1341052 GTGCAGGGGTGCGTGTGTGCAGG - Intronic
900187887 1:1341064-1341086 GTGCAGGGGTGCGTGTGTGCAGG - Intronic
901631166 1:10648887-10648909 GCTGAGGGCTGCATGTGTGAAGG + Intronic
901771201 1:11531254-11531276 GTGCAGAGGTGCATGTGTGTGGG + Intronic
903370970 1:22835986-22836008 TTTCTGGGATGGATGTGTCAAGG - Intronic
905546885 1:38807287-38807309 GTGCAGGTGTGTGTGTGTCAGGG - Intergenic
905563286 1:38943862-38943884 AGTCAGGGTTGCATGAGTCAGGG + Intergenic
905892826 1:41527941-41527963 GGTGTGGGGTGCATGTGTGAGGG - Intronic
906172986 1:43743631-43743653 GTGCAGGTGTGCCTGTTTCATGG - Intronic
918143729 1:181738274-181738296 GTGCACGAGTGCATGTGTCCTGG + Intronic
918689269 1:187460164-187460186 ATTCAAATGTGCATGTGTCATGG - Intergenic
918980126 1:191546586-191546608 GTTCAGGGGTACATGTGCTGGGG - Intergenic
921046824 1:211483693-211483715 GTGCAGGGGTGGGGGTGTCATGG + Intronic
1064160965 10:12945987-12946009 GTTCATGGGTGCATTGGTTAAGG + Intronic
1066201081 10:33143178-33143200 GTTAGGGGATGCATGGGTCAAGG + Intergenic
1066414625 10:35209365-35209387 TTTCAGGCTTGCATGTGTCTGGG - Intronic
1067247493 10:44558743-44558765 ATTCAGAGGTGCATGATTCATGG + Intergenic
1071751804 10:88487298-88487320 GTTCAGGGGTGCATGTGTCATGG - Intronic
1071923055 10:90373174-90373196 GATCAAGGGTGCAGGTGCCAGGG + Intergenic
1072070340 10:91909099-91909121 GTTCGCAGGTGCATGTGTCTGGG - Intronic
1073958883 10:108903339-108903361 GTACAGGGGAGCATGTGCCTAGG + Intergenic
1074355023 10:112774857-112774879 GTTCAAGGGTACATGTTTGAGGG + Intronic
1075408718 10:122211713-122211735 GTTCAGGGGTGGAGGTGGTAAGG + Intronic
1076293897 10:129369105-129369127 ATTCATGTGTGCATGTGTGATGG - Intergenic
1077137418 11:1007997-1008019 GTTCAGGTGTGCGTGCGTTAAGG - Exonic
1077185583 11:1234064-1234086 GTTGGGGGCTGCAGGTGTCATGG + Intronic
1077776388 11:5276492-5276514 GTTCTGGGGTACATGTGCCATGG - Intronic
1083602061 11:63954822-63954844 GTCCAAGTGTGTATGTGTCAGGG - Exonic
1084290426 11:68162042-68162064 GTTCAGGAGAGCAGGAGTCAAGG - Intronic
1084732078 11:71080164-71080186 GGTACGGGGTGCAGGTGTCAAGG - Intronic
1084751016 11:71204570-71204592 GTACAGGCGTCCAGGTGTCAGGG - Intronic
1085464868 11:76716552-76716574 GTTCAGGGGTGGATGGATGAAGG + Intergenic
1085594456 11:77795933-77795955 GTTTAGAGGTGTATGTGTCCAGG + Intronic
1085928257 11:81049129-81049151 GTTCCTGGGTGTCTGTGTCAAGG - Intergenic
1087162177 11:94959453-94959475 GAACAGTGGAGCATGTGTCAGGG - Intergenic
1087700664 11:101432987-101433009 ATTCAGGGCTGCATGTGAGAAGG + Intergenic
1088102807 11:106173744-106173766 GTTCAGAGGAGCATGAGGCAGGG + Intergenic
1089783569 11:120892098-120892120 GGGCAGGGGTTCATGTGGCAAGG + Intronic
1090979159 11:131701829-131701851 GTGGAGGGGTAGATGTGTCATGG + Intronic
1092840792 12:12539458-12539480 GTTTAGGTGTAGATGTGTCAAGG + Intronic
1092940933 12:13406230-13406252 GACCAGGGGTGCATCTGCCATGG + Intergenic
1094816793 12:34194982-34195004 CTTGAGGGGTGTATGTGTCCAGG - Intergenic
1096912078 12:54994582-54994604 GTTCAGGGGTACATGTTACATGG + Intergenic
1098934180 12:76458614-76458636 GTTCAAGGTTGCATGAGTTATGG + Intronic
1099051250 12:77783902-77783924 TTTCATGGGTGTGTGTGTCAGGG + Intergenic
1100838694 12:98591027-98591049 GTTCCAGGGTTTATGTGTCAGGG - Intergenic
1101603617 12:106231691-106231713 GGACAGAGGTGGATGTGTCAAGG + Intergenic
1102495649 12:113317072-113317094 GTTTAGGGGTGCAAGTGTTCAGG + Intronic
1104043013 12:125142754-125142776 GTTCACGTGTGTCTGTGTCATGG + Exonic
1104636594 12:130441528-130441550 GTCCAGGGGTGCATGTGACACGG + Intronic
1104727015 12:131084442-131084464 GTTCACGGGGCCATGTGTTATGG + Intronic
1107879148 13:44817820-44817842 GTTCAGGGCTGCTTGTGACATGG - Intergenic
1111237643 13:85430749-85430771 GGTCAGGGCTGCATGCTTCATGG + Intergenic
1111977517 13:94982544-94982566 GTTCCTGGGTGCATCTGTGAGGG + Intergenic
1113796719 13:113062529-113062551 GTGCAGGGGAGCCTGTGGCATGG - Intronic
1113796944 13:113063931-113063953 GTGCAGGGGAGCCTGTGGCATGG + Intronic
1113913850 13:113859652-113859674 GTACATGTGTGCATGTGTCTAGG + Intronic
1116318508 14:43429132-43429154 GTTCAGGGGTGAATGTTCCTTGG - Intergenic
1120527700 14:85596175-85596197 GTTCAGGGGCGCCTGTTTCCTGG - Intronic
1122210189 14:100168440-100168462 GGGCAGGGGTGCATGTGTGTTGG - Intergenic
1202835309 14_GL000009v2_random:73768-73790 CTTCAGGGGTGCAAGCTTCAAGG + Intergenic
1124641124 15:31397262-31397284 GGGCAGGGGTGCACGTGGCAGGG + Intronic
1125073018 15:35578577-35578599 CTCCAGGTGTGCATGTGTGAAGG + Intergenic
1125741523 15:41968216-41968238 GGGCAGGGGTGCATGTGCAAGGG - Intronic
1126055582 15:44726856-44726878 GTTTGGGGTTGCATGTGTTATGG - Intergenic
1127051386 15:55087841-55087863 GATCAGGTGTTCATGGGTCAGGG - Intergenic
1131169341 15:90165920-90165942 CTGCAGGGGTGCATGCGTGAAGG - Intronic
1131563127 15:93461613-93461635 GTTCAGGGGTGTGTGTGTGCTGG + Intergenic
1132907562 16:2290744-2290766 GTGCAGGGGACCATGTGTCCAGG - Intronic
1134482188 16:14629821-14629843 CTCGAGGGGTGCATGGGTCAGGG + Intronic
1135753146 16:25073125-25073147 GTGCATGAGTGCGTGTGTCAGGG + Intergenic
1137051620 16:35718509-35718531 GTGGAGGGGTGTATGTGTCCAGG + Intergenic
1137365302 16:47854652-47854674 GTTGGGGGGTGCATGTGTATTGG - Intergenic
1138284239 16:55795608-55795630 GTTCTGGTGTGCTTGTGTAAAGG - Intergenic
1138284763 16:55801379-55801401 GTTCTGGTGTGCTTGTGTAAAGG + Intergenic
1140929348 16:79612757-79612779 GTTAAGGGGTGGAGGTGTCGGGG - Intergenic
1142224203 16:88869734-88869756 GCTCAGAGGGGCATGCGTCAGGG - Intergenic
1144888134 17:18477744-18477766 CTTCAGGGGTGACTGTGTCCTGG + Intronic
1145144071 17:20466559-20466581 CTTCAGGGGTGACTGTGTCCTGG - Intronic
1149037112 17:52147036-52147058 ATTGTGGGGTGTATGTGTCAGGG + Intronic
1150492528 17:65584248-65584270 GTGCAGGGCTGCATGACTCATGG - Intronic
1151933260 17:77246770-77246792 GTGGAGGGGTCCAGGTGTCACGG + Intergenic
1151996525 17:77612791-77612813 GGTCAGAGGTGCATGTATCCGGG - Intergenic
1152191910 17:78893297-78893319 GTGCAGGGGTGTATGTGCAAGGG + Intronic
1155680359 18:28479374-28479396 GATCAAGGGTCCAAGTGTCAAGG - Intergenic
1157891680 18:51424110-51424132 TTTCAGGGGAGCATGTGAAATGG + Intergenic
1160045811 18:75386367-75386389 GTTCCTGGGTCCATGGGTCAGGG + Intergenic
1164655865 19:29921335-29921357 ATTCCGGGGTTTATGTGTCACGG + Intergenic
1165601041 19:37056155-37056177 GTACAGGGGAGGCTGTGTCAGGG + Intronic
1167333025 19:48867974-48867996 GTTTGGGGGTGCATGTGGGAGGG - Intronic
1168520981 19:57050324-57050346 GTTCAGGGATACATGTGCCATGG - Intergenic
925129158 2:1482143-1482165 GTTCAGAGGAGCCTGTGCCAGGG + Intronic
925891500 2:8438623-8438645 GCCCAGGGGTGCATGCATCAGGG - Intergenic
928299298 2:30111336-30111358 GCTCCGGCGTGCAGGTGTCACGG + Intergenic
928299304 2:30111384-30111406 GCTCCGGCGTGCAGGTGTCACGG + Intergenic
928299310 2:30111432-30111454 GCTCCGGCGTGCAGGTGTCACGG + Intergenic
928458420 2:31446794-31446816 GTTCAGCCGTGCATCTGTGATGG + Intergenic
928619861 2:33077629-33077651 GTTCGGGGGTGCCTGGATCATGG - Intronic
929206833 2:39305672-39305694 GTACAGGGGAGCATTTGACAGGG - Intronic
930237727 2:48903808-48903830 GTTGAGGGGTTCATGCCTCAGGG + Intergenic
930479017 2:51923883-51923905 GTGGAGGGGTCCATGTGGCAAGG + Intergenic
931071557 2:58657289-58657311 GTTCAAGGATGCATGTGTGGCGG + Intergenic
931286320 2:60834901-60834923 GGTCGGGGGTGCATTTGTAAAGG + Intergenic
935026460 2:99281843-99281865 GTGCATGTGTGCATATGTCATGG - Intronic
937028721 2:118720546-118720568 GTACATGGGTGCCTGTGTCCTGG - Intergenic
937848215 2:126605380-126605402 GTTCAGTGGTGTATCTGTTAAGG - Intergenic
938995183 2:136670791-136670813 TTACAGAGCTGCATGTGTCAGGG + Intergenic
940576765 2:155517536-155517558 TCTCAGGAGTGCATGTGCCAAGG + Intergenic
941036318 2:160572810-160572832 GTTCCTGGGTGCATCTGTGAGGG + Intergenic
942652466 2:178183005-178183027 AGTCAGGTGTGGATGTGTCAAGG + Intergenic
944620875 2:201514982-201515004 GTTTAGGGGTGCATCTGACCTGG - Intronic
945334787 2:208579446-208579468 ATTCAGGGGTACATGTGCCCCGG - Intronic
947060379 2:226157752-226157774 GTTCAGGGGGGTATGTGTGTAGG + Intergenic
947583079 2:231333735-231333757 GGTCAGGGGTACATGCGTCGCGG - Intronic
948354226 2:237364935-237364957 GTGCATGTGTGCATGTGTTATGG + Intronic
1169316947 20:4600619-4600641 GTCTAGGGGTGCAATTGTCAAGG + Intergenic
1171243152 20:23587567-23587589 ATTCAGAGGTGCATGTCACATGG + Intergenic
1172037866 20:32022752-32022774 GTTCAGGTGTGGATGTGTAGTGG - Exonic
1172962420 20:38807862-38807884 GCTCTGTGGTTCATGTGTCAAGG + Intronic
1174526548 20:51176395-51176417 GCTCAGGCGTGCATGTGCCCAGG + Intergenic
1176994218 21:15535575-15535597 GCTCAGGGGTACATGTGTGCAGG + Intergenic
1177241525 21:18464676-18464698 TTGCAGGGGTGTATGTGTCCAGG - Intronic
1177418814 21:20828432-20828454 GTTCCTGGGTTTATGTGTCAGGG - Intergenic
1177775292 21:25560546-25560568 GTGCAGTGGGGCATGTGGCAAGG - Intergenic
1179558901 21:42200185-42200207 GTTCAGGTGGGCCTGTGGCAGGG + Intronic
1179904714 21:44416478-44416500 CTCCAGGGGTGCATGTGGAAGGG - Intronic
1185049921 22:48548631-48548653 GTTCAGGGCTGCATTTCACAGGG + Intronic
1185337754 22:50278349-50278371 GGGCAGGGGTGCATGTGTCCAGG + Intronic
1185373426 22:50471185-50471207 GTTCAGAGGTGGAGGTGGCAAGG - Intronic
949910736 3:8905141-8905163 GTTCTGGTGGGCATGTGTCCTGG + Intronic
950093800 3:10316198-10316220 GTTCAGTGGTGCAGGAGGCATGG - Intronic
952013791 3:28933021-28933043 CTTCAAGGGAGCATGTGCCAGGG - Intergenic
952983454 3:38756906-38756928 ATTCAGGGGTCCATGTGCTATGG - Intronic
953039181 3:39239638-39239660 AGTCACGGGTACATGTGTCATGG + Intergenic
954297335 3:49681578-49681600 CTTCTGGGGTCCATGTGTCATGG + Intronic
956523955 3:70136389-70136411 ATGGAGGGGTTCATGTGTCAAGG + Intergenic
956805320 3:72804307-72804329 GTTCAGAGGTATGTGTGTCATGG + Intronic
957230554 3:77508883-77508905 CAACAGGGGTGCATGTGTGAGGG + Intronic
960847255 3:122016024-122016046 GTGCATGGCTGCATGGGTCATGG - Intronic
967972552 3:195010283-195010305 GTTTAGGGGTGTATGTGTGTAGG - Intergenic
968880945 4:3299868-3299890 GTCCAGGGGTCCAGGGGTCATGG - Intronic
971565363 4:28132742-28132764 GTTCCGGGGTGTATCTGTGAGGG + Intergenic
972695239 4:41438990-41439012 GGTGAGGGGAGCATCTGTCAGGG + Intronic
975606394 4:76158650-76158672 ACTCAGGGCTGCATCTGTCAAGG + Intergenic
976938215 4:90666040-90666062 ATTGAGGGGGGCATGTGACAAGG - Intronic
978075703 4:104527077-104527099 GTTCAGGGGTACATGTGCCATGG + Intergenic
981643048 4:146967346-146967368 CTGCAGGGGTGCATCTCTCATGG + Intergenic
981750467 4:148088793-148088815 GTTCTGGGGTACACGTGCCATGG - Intronic
982623519 4:157734255-157734277 ATTCACGGGTCCATGAGTCAAGG + Intergenic
983872121 4:172834642-172834664 CTCCAAGGGTGCATTTGTCAGGG - Intronic
1202764632 4_GL000008v2_random:139437-139459 CTTCAGGGGTGCAAGCTTCAAGG - Intergenic
986789089 5:11143258-11143280 GTACAGGGGTGCAAGTGTATAGG - Intronic
988020460 5:25614550-25614572 GCTAAGGAGTGCACGTGTCATGG - Intergenic
989565467 5:42896908-42896930 GTTTAGGTGAACATGTGTCATGG - Intergenic
990175789 5:53106644-53106666 GTTCAGGGGAACTTGTATCATGG - Intronic
992162956 5:74020368-74020390 GTTCAGGGGTGCACTTTCCATGG + Intergenic
993032641 5:82723147-82723169 GTGCTGGGGAGCATTTGTCATGG + Intergenic
994941842 5:106333825-106333847 AGTCAGGGGTGTTTGTGTCATGG - Intergenic
997826504 5:137111459-137111481 GTGTATGGGTGCGTGTGTCAGGG - Intronic
1000102662 5:158031649-158031671 GTTCTGGGATACATGTGTCTGGG + Intergenic
1000544949 5:162587853-162587875 GTCAAGGGGTACATGTGCCACGG + Intergenic
1000772416 5:165372104-165372126 GTTCAGGCTTTCAAGTGTCATGG - Intergenic
1001795943 5:174502484-174502506 GGTCAGGGGCGCATGTGGTAGGG - Intergenic
1004076260 6:12346689-12346711 GTTCAGGGTTGCAGGTGGCTGGG - Intergenic
1004542796 6:16567473-16567495 CTGCAAGGGTGCATGTGTGAGGG + Intronic
1004798055 6:19111421-19111443 GTTCTGGGGTACATGTGTACAGG - Intergenic
1010073211 6:71768713-71768735 GTTCAGAGGCACATGTGGCAAGG - Intergenic
1011179328 6:84602224-84602246 TTGGAGGGGTGTATGTGTCAAGG - Intergenic
1014271767 6:119344509-119344531 GTTCAGTAGGGAATGTGTCACGG + Intronic
1016439745 6:144070748-144070770 GTTCAGTGGTGTATTAGTCAGGG - Intergenic
1019339436 7:501837-501859 GTTCTGGGGTGCAGGTGGCCAGG + Intronic
1020114766 7:5470332-5470354 GTGGAGGGGTGGATGTGTGAGGG - Intronic
1021891326 7:25188733-25188755 GCTCAGCGGTGCAGGTGTCAGGG + Intergenic
1022807149 7:33833878-33833900 GTGCAGGGATGAATCTGTCATGG + Intergenic
1026377687 7:69768530-69768552 GTCCAGAGCTGCATGTGTTAAGG - Intronic
1028744302 7:94309815-94309837 GGACAGGGGGGCATGTGACAGGG - Intergenic
1029146892 7:98452771-98452793 GGTCAGAAGTGCATGTGTCTTGG + Intergenic
1029175931 7:98664451-98664473 ACTCAGGGGTGCATGGGTCATGG + Intergenic
1031606186 7:123770631-123770653 GCTCAGGGGAGCATTAGTCATGG + Intergenic
1032495360 7:132357398-132357420 CATCAGGAGTGCATGTCTCAAGG + Intronic
1033227738 7:139574612-139574634 GTGCAGGGCTGTCTGTGTCAAGG - Intronic
1035079591 7:156204849-156204871 TTTCAGGTGTGCATGTGCCAGGG - Intergenic
1037142467 8:15535755-15535777 GTTAAGGAGTGTGTGTGTCAAGG + Intronic
1038580550 8:28745127-28745149 GTTCAAGGCTGAATGTGCCATGG + Intronic
1040558776 8:48505157-48505179 GTTGAGGGGTGCACTTGTGAGGG + Intergenic
1042397019 8:68304654-68304676 GTTCAGGAGTTCAGGTGTCATGG + Exonic
1042687179 8:71455173-71455195 CTTGTGGGGTGTATGTGTCAAGG - Intronic
1042972115 8:74420866-74420888 GTTCTGGGGTACATGTGCCATGG + Intronic
1048499387 8:134961868-134961890 GTTCCTGGGTGCATCTGTGAGGG + Intergenic
1048911742 8:139141748-139141770 GTTCAGGGAAACATGTGACATGG - Intergenic
1049253376 8:141601134-141601156 GGTCACGGGTGCAGGTGTCTCGG - Intergenic
1050629001 9:7539108-7539130 GTTGATGTGTGCATGTGTCTGGG - Intergenic
1051237544 9:15017586-15017608 ATTCATGTGTGTATGTGTCAGGG - Intergenic
1052268428 9:26601292-26601314 TTTCAGGAGAGCATGTGTGATGG - Intergenic
1053846987 9:42249554-42249576 GTTCCTGGGTGTATGTGTGAGGG + Intergenic
1055609399 9:78005672-78005694 GTGCAGTAGTGCATGGGTCAAGG + Intronic
1056927036 9:90843986-90844008 GTCCAGGGGGGCATGAGTGATGG + Exonic
1056994501 9:91443567-91443589 GTTCAGGTGTGCATGTGCTTGGG - Intergenic
1057031920 9:91782656-91782678 GTCCTGGGCTGCATGTGCCACGG + Intronic
1059003914 9:110380942-110380964 ATCCAAGGGTGCATGTGTCCAGG + Intronic
1060198879 9:121640341-121640363 GTGCATGGGAGCCTGTGTCAGGG + Intronic
1062009249 9:134258400-134258422 GGTCTGGGCTGCAGGTGTCAGGG + Intergenic
1062145806 9:134989064-134989086 CTTCAGCGGTGTGTGTGTCAGGG + Intergenic
1062643877 9:137536468-137536490 GTTCAGGCGTGAATCTGTAATGG + Intronic
1203378637 Un_KI270435v1:5913-5935 GTTGGGGAGTGCATGTGTCAAGG + Intergenic
1203545382 Un_KI270743v1:124325-124347 CTTCAGGGGTGCAAGCTTCAAGG - Intergenic
1189414808 X:40804378-40804400 CTTCATGGGTGCATGTTGCATGG - Intergenic
1190917530 X:54821527-54821549 GTTCAAGGGTGGGTGTCTCAGGG + Intergenic
1196365039 X:114914564-114914586 GTACAGGCCTGTATGTGTCAGGG + Intergenic
1197720591 X:129742237-129742259 GTGCAGGGGTGCGTGGGGCAGGG - Intronic
1197893559 X:131288536-131288558 GTTTAGGGGTCCAAGTGGCAAGG - Intronic
1199531403 X:148851770-148851792 GTTTGGGGGTGCATGTGACACGG + Intronic
1200079093 X:153566719-153566741 GTGCAGGGGTGCAGGTGTGCAGG - Intronic
1202182038 Y:22147904-22147926 GTTGAGGGGTCTTTGTGTCATGG + Intergenic
1202209322 Y:22438498-22438520 GTTGAGGGGTCTTTGTGTCATGG - Intergenic