ID: 1071752517

View in Genome Browser
Species Human (GRCh38)
Location 10:88496499-88496521
Sequence CTTGAACCAGAATTGGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071752515_1071752517 8 Left 1071752515 10:88496468-88496490 CCTGGTTAACTTCTGGACTGGAG 0: 1
1: 0
2: 0
3: 9
4: 88
Right 1071752517 10:88496499-88496521 CTTGAACCAGAATTGGAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071752517 Original CRISPR CTTGAACCAGAATTGGAGAA AGG Intronic
No off target data available for this crispr