ID: 1071766861

View in Genome Browser
Species Human (GRCh38)
Location 10:88676550-88676572
Sequence TGTGCTGGGGATCTGGGATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 398
Summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 360}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071766861 Original CRISPR TGTGCTGGGGATCTGGGATA TGG (reversed) Intronic
900622715 1:3594765-3594787 TGTGCTGGGGCTCAGAGATGGGG - Intronic
900649615 1:3724370-3724392 TGTCCTGGGGGTCTGGTACAGGG - Intronic
901187443 1:7384150-7384172 TGTGCCAGGGATGTGGGAAAAGG + Intronic
902758497 1:18565400-18565422 TGTGCTGGGACTCTGGCAGAGGG + Intergenic
902866238 1:19281781-19281803 TGTGCCCAGGATGTGGGATATGG + Intergenic
903351092 1:22716945-22716967 TTAGCTGGAGATCTGGGAGATGG + Intronic
903800945 1:25967748-25967770 TGTGATGGGGAACAGGGAGATGG + Intronic
904887720 1:33753773-33753795 TGTGCCCAGGATGTGGGATATGG + Intronic
905260991 1:36719116-36719138 TGTTATGGTGATCTGGGATTAGG - Intergenic
905898881 1:41567555-41567577 GGTGCTGGGCCTCAGGGATAAGG + Intronic
906932817 1:50186411-50186433 AGTGCCTGGGATCTGGGATCAGG + Intronic
907329716 1:53663135-53663157 GGTGCTGGGGGTCTGGACTAGGG - Intronic
907866884 1:58407220-58407242 TGTGCTGCAGAGCTGGGAGAAGG + Intronic
908006743 1:59735874-59735896 TGTGCTCAGGAGCTGGGAAAAGG + Intronic
908071898 1:60469687-60469709 TGTGCTGGGGGTGGGGGAAAGGG - Intergenic
908495575 1:64691027-64691049 TGGTTTGGGGATTTGGGATAAGG + Intronic
910428578 1:87139435-87139457 TGTACTGGGCATCTTGGTTAAGG + Intronic
913263935 1:117026153-117026175 TCTGCTGGGGTTCAGGGAGAAGG + Intronic
914897848 1:151692844-151692866 AGTGCTGGGGAACTGAGGTAGGG - Intronic
914901479 1:151713462-151713484 TCTGCAGGGGCTCTGAGATAGGG + Intronic
918439137 1:184548197-184548219 TGTGTTGGGGATTTGAGATATGG - Intronic
918931202 1:190858951-190858973 TGTGCCTGGGATTTGGGACATGG + Intergenic
920500180 1:206480677-206480699 TGAGGTGGGGATAAGGGATAGGG - Intronic
921271496 1:213474255-213474277 TCTGCTTGGGAACTGGGATCCGG - Intergenic
921455680 1:215368198-215368220 TGTGCTGGGAGTTGGGGATACGG + Intergenic
921498897 1:215876071-215876093 TGTGCTGAGGCACTGTGATAAGG - Intronic
921584277 1:216929479-216929501 TGTGGAGGGGAGCTGGGAGAGGG + Intronic
921794963 1:219332210-219332232 GGAGCTGGGGATGTGGGATAAGG + Intergenic
921867084 1:220097283-220097305 TGTGCTGGGGGTCTGGGGTGGGG - Intronic
922577037 1:226667686-226667708 TCTCCTGCAGATCTGGGATAGGG + Intronic
922823432 1:228500874-228500896 TGTTCTGGTGATCTGTGATCAGG - Intergenic
923805888 1:237257589-237257611 TGTGCTGGGTACCAGGGATGCGG + Intronic
924476828 1:244389691-244389713 TATGCTGGGGAACTGGGGGAGGG - Intergenic
1062947686 10:1473771-1473793 TGGACTGGAAATCTGGGATAAGG + Intronic
1063167257 10:3474500-3474522 TGTGCTGGGGACAGGGGACAGGG - Intergenic
1063734617 10:8739186-8739208 TGTGCTGGAGAGCTGAGAGATGG + Intergenic
1065041809 10:21705287-21705309 TGTCCTGGGGATCTGAGGTTAGG - Intronic
1065371010 10:24986361-24986383 TGAGCTAAGGATCTGGGAAAGGG + Intronic
1065436419 10:25707869-25707891 TGTGCTGGGGGACTGGGCTCTGG + Intergenic
1067109325 10:43388677-43388699 TGTGCTGAAGATCTGGAAGAGGG + Intronic
1067539002 10:47138172-47138194 AAGGCTGGGGATCTGGGATCTGG + Intergenic
1067575216 10:47404455-47404477 TGTGCTGTGGGTTTGGGAGAGGG + Intergenic
1067783037 10:49222946-49222968 TGTGCCCAGGATATGGGATATGG - Intergenic
1067985593 10:51140339-51140361 TGTGCTAGGGATTAGGGGTAAGG - Intronic
1068117553 10:52751398-52751420 TGTGCTGGGGGTGAGGGATCAGG - Intergenic
1068302878 10:55168229-55168251 TGGGCTTGGGGTCGGGGATAGGG - Intronic
1069588894 10:69630111-69630133 GGTGCTGGGGGTCGGGGAGATGG - Intergenic
1069997097 10:72349045-72349067 TGGGGTGGGGATCGGGGACAGGG + Intronic
1070688807 10:78509683-78509705 TGTGCTGGGGCTGGGGGATGAGG - Intergenic
1071035697 10:81241576-81241598 TGTGCTGGGGATAGGGAATGTGG + Intergenic
1071286811 10:84156187-84156209 TGTGCTCGGTATCTGGGTGATGG + Intergenic
1071509387 10:86251592-86251614 TGGCCTGGGGATCTGGGATCAGG + Intronic
1071766861 10:88676550-88676572 TGTGCTGGGGATCTGGGATATGG - Intronic
1072539088 10:96384808-96384830 TGTGCTGGGGGTCTGGGGTGGGG - Intronic
1073251418 10:102122028-102122050 TGTGCTTAGGATGGGGGATAGGG + Intergenic
1074188773 10:111117841-111117863 TGGTCTGGGGGTCTGGGGTAAGG + Intergenic
1074413480 10:113247410-113247432 TGTACTGGGGTTCTAGGAGAGGG - Intergenic
1074493505 10:113959352-113959374 TGTGCTGGGGGTATGGGGAAAGG - Intergenic
1077836719 11:5932824-5932846 TCTGATGGGGATCTAGGATGGGG - Intronic
1078754791 11:14199115-14199137 TTTGCTGGGCATGTGGGATTCGG + Intronic
1078909893 11:15721033-15721055 AGAGCTGGGAATCAGGGATATGG - Intergenic
1078994705 11:16685539-16685561 TGTGCCAGGGATGTGGGACATGG - Intronic
1079214250 11:18493058-18493080 TGTGTTGGGGACTTGGGGTATGG - Intronic
1081668551 11:44930693-44930715 TGTGCTGGGGATCTGAGGTTTGG + Exonic
1081720877 11:45287239-45287261 TGTGCTGGGCATGTGTGAAAAGG + Intergenic
1081995984 11:47364429-47364451 TGTCCTGGGGCTCTGGGATTTGG + Intronic
1082780577 11:57284371-57284393 TGTGCTCTGGATGTGGGACATGG + Intergenic
1083174720 11:60942368-60942390 TGTGCCTGGGCTCTGGGATAAGG - Intronic
1084591777 11:70094477-70094499 TGTGCTGATGAGCTGGGATTAGG - Intronic
1084642984 11:70436986-70437008 GGTGCTGGGGAGCTGGGTTCCGG + Intergenic
1084686929 11:70701800-70701822 TATACTTGGGCTCTGGGATATGG + Intronic
1085086518 11:73671546-73671568 TGTGCCCTGGATGTGGGATATGG - Intergenic
1087131781 11:94675032-94675054 AGAGCAGGGGACCTGGGATAAGG - Intergenic
1087219716 11:95533255-95533277 TGTGTTGGGGATTTGGGGGAAGG - Intergenic
1088058393 11:105611990-105612012 TGTGCTGGGAATCAGGGGGAGGG + Intronic
1090931141 11:131299143-131299165 TGTGCTGGGGAGGTGGGGTAGGG - Intergenic
1091142038 11:133243685-133243707 TTTGCAGGGGATCTGGGAGTGGG + Intronic
1091595806 12:1878430-1878452 TGTGCTGGGCATCTGGAGTTGGG + Intronic
1091596492 12:1882337-1882359 TGTGATGGGGATTTGAGAAATGG + Intronic
1092246214 12:6865855-6865877 TGGGCTGTGGATTTGGGGTATGG + Intronic
1093371956 12:18376260-18376282 TGTGCTTGGAATGTGGGATATGG + Intronic
1095956317 12:47808440-47808462 GGAGCTGGGGATCTGGGGTGGGG - Intronic
1096468891 12:51864195-51864217 TGTGCCGGGGGTCTGGGAGGCGG - Intergenic
1096828022 12:54294374-54294396 TCTGCTGGGCATCTGGGGCATGG - Intronic
1097124550 12:56763478-56763500 TGTGTAGGGGATATGGGATATGG + Intronic
1097286211 12:57879491-57879513 TGGGATGTGGATGTGGGATATGG + Intergenic
1097286234 12:57879591-57879613 TGGGCTATGGATGTGGGATATGG + Intergenic
1097286242 12:57879624-57879646 TGGGCTACGGATGTGGGATATGG + Intergenic
1097286267 12:57879731-57879753 TGGGCTATGGATGTGGGATATGG + Intergenic
1097286276 12:57879770-57879792 TGGGCTATGGATGTGGGATATGG + Intergenic
1097286300 12:57879873-57879895 TGGGCTATGGATGTGGGATATGG + Intergenic
1098289621 12:68945453-68945475 TGAGCTGGGGAGATGGGAAAAGG + Intronic
1099460918 12:82919780-82919802 TGTGCTCAGGATATGGGACATGG - Intronic
1102063175 12:109950736-109950758 TAAGGTGGGGATGTGGGATAGGG + Intronic
1104041599 12:125134471-125134493 TGTGATGGGGTTCTCGGGTAGGG + Intronic
1104730660 12:131103674-131103696 TGTCCTGGTGATCGGGGAGAAGG + Intronic
1105260688 13:18777144-18777166 TGTGCTCGGGATGTGGGATCTGG - Intergenic
1105262979 13:18793550-18793572 TGTGCTCTGGATGTGGGATCTGG - Intergenic
1105566926 13:21558649-21558671 TGGGCTGGGGTTCTGGGGTTGGG + Intronic
1106027228 13:25966891-25966913 TGTGCAGGGGAAAGGGGATAGGG + Intronic
1108662690 13:52600602-52600624 TGGGCTGGGGATGAGGGCTAGGG + Intergenic
1109603486 13:64662776-64662798 AGTGCAGGGGTGCTGGGATATGG - Intergenic
1110983929 13:81939444-81939466 TATGCTGGGGAACTGGGGTTAGG + Intergenic
1111994144 13:95146472-95146494 TGTGCTGGGAATTTTGCATAAGG - Intronic
1112246816 13:97742841-97742863 TGTCCTGGGGACCTGGGCTCAGG - Intergenic
1113636073 13:111920013-111920035 TCTGCTAGGGATCTGGGGCACGG - Intergenic
1115536021 14:34374063-34374085 TCTGCTGGGGATCTGTAAAAAGG - Intronic
1115876436 14:37867075-37867097 TGTGCTGGGGATATGGGACCAGG + Intronic
1119173510 14:72552427-72552449 TGTTGTGGGGATCTGGCATTTGG + Intronic
1121265940 14:92602705-92602727 AGTGCTGGGAATTTGGGAGAAGG + Intronic
1121798752 14:96756106-96756128 TCTTCTGGGGATCTGGGCTGTGG + Intergenic
1125415467 15:39447863-39447885 AGGGCTGGGGATTTAGGATATGG + Intergenic
1125590928 15:40854104-40854126 TGTGGTGGGGATGGGGGATGGGG - Intronic
1125860312 15:42992922-42992944 TGTGGTGAGGAACTGGGAAAAGG - Intronic
1126794152 15:52246132-52246154 TCTGCTGGGTACCTGGCATAGGG - Intronic
1127114047 15:55706432-55706454 TGTGGTGGGAATTTGGGGTATGG + Intronic
1128389037 15:67170571-67170593 TGTGCTGGGGACATCGGATTCGG - Exonic
1128581492 15:68813565-68813587 GGTGCTGGGGGACTGGGAGAGGG + Intronic
1129150844 15:73686959-73686981 TGCCCTGGGGATGTGGGAAAAGG - Intronic
1129385851 15:75195819-75195841 TGAACTGGGGATCTGGGGGAAGG + Intronic
1130120504 15:81043364-81043386 TGTACTGGGCAGCTGGGGTAGGG + Intronic
1131249782 15:90822678-90822700 TGGGCTGGGGATCTGTGGGAGGG + Intergenic
1131922198 15:97340334-97340356 TGTGCTGGGGACATGGGTTTTGG + Intergenic
1132346543 15:101112246-101112268 GGTCCTGGGGATCTGGGATACGG - Intergenic
1132655729 16:1041015-1041037 TGAGCTGGGGGTCTGGGAGGAGG - Intergenic
1132655737 16:1041040-1041062 TGAGCTGGGGGTCTGGGAGGAGG - Intergenic
1132655781 16:1041173-1041195 TGAGCTGGGGGTCTGGGAGCAGG - Intergenic
1132655852 16:1041399-1041421 TGAGCTGGGGGTCTGGGAGGAGG - Intergenic
1132655860 16:1041424-1041446 TGAGCTGGGGGTCTGGGAGGAGG - Intergenic
1132655868 16:1041449-1041471 GGAGCTGGGGGTCTGGGATGAGG - Intergenic
1133449536 16:5891981-5892003 TGTGCTGGGTATCGGGGAGAGGG + Intergenic
1136368469 16:29820884-29820906 TGTCCTGGGGACCTGGGCTCTGG + Intronic
1136573591 16:31110555-31110577 TGGGCTGGGGATCCGGGTCAAGG + Intronic
1136598071 16:31265571-31265593 TGTCCTGGGGATCTGTGGTGGGG + Intronic
1138595770 16:58028196-58028218 TGAGCTGGGGAGTTGGGGTAGGG - Intronic
1139210221 16:65069875-65069897 TGTGCTGGGGACCAGGGACACGG + Intronic
1140097189 16:71884562-71884584 GGTGGTGGGGATCCGGGCTAAGG - Intronic
1140620945 16:76731545-76731567 TCTACTGGGGACCTGTGATAGGG + Intergenic
1141931748 16:87209622-87209644 TGAGCTGGGGCTCTGGGATTAGG - Intronic
1142496559 17:309425-309447 CCTGCTGGGGGTCCGGGATACGG + Intronic
1142496579 17:309480-309502 CCTGCTGGGGGTCCGGGATATGG + Intronic
1142496604 17:309540-309562 CCTGCTGGGGGTCCGGGATATGG + Intronic
1142496645 17:309653-309675 CCTGCTGGGGGTCTGGGATATGG + Intronic
1143476696 17:7207286-7207308 TGGGCTGGGGATCAGGGAGAGGG + Intronic
1144630533 17:16869923-16869945 TGTGCTGGGGATATGGCCTGGGG - Intergenic
1144650788 17:17005532-17005554 TGTGCTGGGGATATGGCCTGGGG + Intergenic
1145275452 17:21426581-21426603 TGTGCTGGGGAACGGGGAGGAGG + Intergenic
1145313305 17:21712475-21712497 TGTGCTGGGGAACGGGGAGGAGG + Intergenic
1145711753 17:26984430-26984452 TGTGCTGGGGAGCAGGGAGGAGG + Intergenic
1145741800 17:27281040-27281062 AGTGCTGGGGATTTGGCATTAGG + Intergenic
1146378583 17:32311874-32311896 TGAGGTGGGGAACTGAGATAAGG + Intronic
1146511506 17:33453208-33453230 TGTATTGGGGAGCTGGGGTATGG + Intronic
1146765401 17:35516290-35516312 TATGCTGGGGAGCTGGAAAATGG - Intronic
1147124498 17:38356733-38356755 TGTTCTGGGGAACTGGGCTAGGG + Intronic
1148543681 17:48500670-48500692 TGTCCTGCTGATCTGGGATGGGG + Intergenic
1149468385 17:56897377-56897399 TGTGATGGGGGTCTGGGGGAGGG - Intronic
1150654780 17:67032650-67032672 TGTGCTGGGGATCTGAAATGAGG + Exonic
1150989929 17:70245399-70245421 TGTGCTAGGTATCTGGAATTTGG - Intergenic
1151675864 17:75597016-75597038 TGTGCTGAGGAACTGTGATCAGG - Intergenic
1151966448 17:77434098-77434120 TGGGCTGGGGATCTGTGTTGGGG + Intronic
1152678948 17:81655891-81655913 GGTGCTGGGCACCTGGGATTGGG + Intronic
1152696589 17:81800725-81800747 TGTGCTGGGGATTCTGGAGACGG - Intergenic
1153524935 18:5985900-5985922 TGTGGTTGGGATCTTGGAGAGGG + Intronic
1154425328 18:14267648-14267670 TGTGCTCTGGATGTGGGATCTGG + Intergenic
1154428060 18:14287233-14287255 TGTGCTCTGGATGTGGGATCTGG + Intergenic
1154433023 18:14322887-14322909 TGTGCTCTGGATGTGGGATCTGG + Intergenic
1155182343 18:23358699-23358721 TGTGCTGGGTATATTGGTTATGG - Intronic
1155593195 18:27452367-27452389 TGGGATGGGGAACTGGGATGGGG + Intergenic
1155973961 18:32108197-32108219 TGAGCTGGATATCTGTGATAGGG - Intronic
1156547233 18:37976384-37976406 TGTGATGGATATCAGGGATATGG + Intergenic
1159825143 18:73198934-73198956 TGTGCTGTGTATATGGGACAGGG - Intronic
1159944727 18:74435837-74435859 TGTGTTGGGGATGTGGGTTAGGG - Exonic
1160010099 18:75100857-75100879 TGTGCCCAGGATATGGGATATGG - Intergenic
1160580883 18:79884159-79884181 TGTGCTGGGGAGCTGAGCTCTGG - Intronic
1160621442 18:80174010-80174032 TGGGCGGTGGCTCTGGGATAGGG - Intronic
1160817744 19:1043851-1043873 GGTGCTGGGGAGGTGGGATGTGG + Intronic
1161073822 19:2275503-2275525 CGTGCTGGGGATGTGGGTCAAGG - Exonic
1165886898 19:39084792-39084814 AGTGCTGGGGGTCTGGGAGCGGG - Intronic
1166142001 19:40810275-40810297 TGTACTCGGGATTTGGCATAAGG + Intronic
1166185524 19:41136518-41136540 TGTACTCGGGATTTGGCATAAGG - Intergenic
1166301186 19:41913020-41913042 TGGGGTGGGGACCTGGGAGAGGG - Intronic
1166565698 19:43764186-43764208 AGTGCTGGGGCTCTGGGGTCAGG + Intergenic
1167555954 19:50195883-50195905 TGTGTTGGGCATCTGGGTGAAGG - Intronic
1167668046 19:50834047-50834069 TGGGCTGGGGGTCTGGAATCTGG + Intronic
1167683769 19:50942764-50942786 TGTGCTGGGGATAAGGCATTGGG - Intergenic
1167716290 19:51144581-51144603 GGTGCTGGGGCTGTGGGATGAGG - Exonic
1168334619 19:55590713-55590735 TATTCTGGGGGTCTGGTATAGGG + Intergenic
926089203 2:10039203-10039225 TATGCAGGGGATCAGGGAAACGG + Intergenic
926749291 2:16185814-16185836 TGGGCTGGGGCTGTGGGATGAGG + Intergenic
927673148 2:25085811-25085833 TGTGCTATGAATCTGGGATGGGG + Intronic
927699131 2:25256966-25256988 TGGGCAGTGGATTTGGGATAAGG - Intronic
927895307 2:26777987-26778009 TGTGCTGGGGGTCTGGGGGAAGG + Intronic
928249116 2:29659402-29659424 TGGGCTGGGGAGATGGCATAGGG + Intronic
928980062 2:37128120-37128142 TGTGCTGGGCATCAGGTTTATGG - Intronic
929005071 2:37386081-37386103 TGTGCTGGGGGGTTTGGATAAGG - Intergenic
929244460 2:39686591-39686613 TGTGCTGCAGCTCTGGGCTACGG + Intronic
929447169 2:42010720-42010742 GGTGCTTGGGATCTGGGATTTGG - Intergenic
930180551 2:48351540-48351562 TGAGGTGGGGACATGGGATATGG + Intronic
932355422 2:71064566-71064588 TCTGCTGTTGATCTGGGATGAGG - Intronic
932445327 2:71777460-71777482 GGTGCTGGGGAACTGGGAGGGGG + Intergenic
933979822 2:87540523-87540545 TGTGCTGGAGATCTGGGCATGGG - Intergenic
934492181 2:94769041-94769063 TGTGCCGTGGATGTGGGACAAGG - Intergenic
934492768 2:94773057-94773079 TGTGCTCTGGATGTGGGATCTGG - Intergenic
934736980 2:96694464-96694486 GGTGCTGGCGATGTGGGATGGGG + Intergenic
936313998 2:111410268-111410290 TGTGCTGGAGATCTGGGCATGGG + Intergenic
937103204 2:119287434-119287456 TGTGGTGGGGTTGTGGGAGAGGG - Intergenic
937323679 2:120976074-120976096 TGTGCTGGGGAGTTGGGAGGTGG - Intronic
938086422 2:128405051-128405073 TGTGCTGGGGCTCTGGGAGAAGG + Intergenic
939634592 2:144565966-144565988 TGTGGTGGGGATATGAGACATGG + Intergenic
939839101 2:147165309-147165331 TTTGATGGGGCCCTGGGATATGG + Intergenic
941305033 2:163854008-163854030 TGTGGTGGGGGTCTGGGGGAGGG - Intergenic
941857082 2:170242367-170242389 TATTCTGGGGATCTGGAACAGGG - Intronic
942450378 2:176105214-176105236 TGTGCTGGGGGTCTGGGTTGAGG + Intronic
943876231 2:193071321-193071343 TGTGCCTGGGATGTGGGACATGG + Intergenic
945419377 2:209616013-209616035 TGGACAGGGGATGTGGGATAGGG - Intronic
946083913 2:217151820-217151842 TGTGGTGTGGATATGGGATGGGG + Intergenic
947189953 2:227493698-227493720 TGTGCTGGGTATTAGGGATGTGG + Intronic
947829685 2:233130218-233130240 TTGGCTGGGGGTCTGGGAAATGG - Intronic
948156588 2:235788393-235788415 TGTGGTGCGGATCTTGGATGAGG + Intronic
1170072232 20:12381382-12381404 TGGGTTGGGGAACTGGGATGGGG - Intergenic
1170982589 20:21228585-21228607 AGTGCAGGGGCTCTGGGACAGGG - Intronic
1171068898 20:22046819-22046841 TGTGCTGGTGACCTAGGACAGGG + Intergenic
1171208459 20:23299186-23299208 TGGGCAGGGGAGCTGGGATTTGG - Intergenic
1172179321 20:32991237-32991259 CGTGCTGGGGATCCAGGATCGGG - Intronic
1173306902 20:41859089-41859111 TGTGCTAGGTACCAGGGATATGG - Intergenic
1173314761 20:41933047-41933069 TGTGCTCTGGATGTGGGACATGG + Intergenic
1173568932 20:44064569-44064591 TTGGCTGAGGAACTGGGATATGG + Intronic
1174643430 20:52064993-52065015 TGTGCTGGGGAGGAGGGAGAAGG + Intronic
1175543030 20:59760057-59760079 TTTGCTGGGGGTCGGGGAGAGGG + Intronic
1177288367 21:19079192-19079214 TGTGCCTGGGATGTGGGACATGG + Intergenic
1178229430 21:30764345-30764367 TGTGCTGGGGTGCTGGGATGGGG + Intergenic
1179567157 21:42256330-42256352 TCTGCTGGGGCTCCGGGACATGG + Intronic
1180787657 22:18555955-18555977 CTTGCTGGGAATCTGGGTTAAGG + Intergenic
1180798486 22:18619692-18619714 TGAGCTGGGGAGCTGGGCCAGGG - Intergenic
1180895194 22:19326472-19326494 AATGATGGGGATCGGGGATAGGG + Intergenic
1181234082 22:21439351-21439373 CTTGCTGGGAATCTGGGTTAAGG - Intronic
1181244565 22:21495480-21495502 CTTGCTGGGAATCTGGGTTAAGG + Intergenic
1181255507 22:21560053-21560075 TGAGCTGGGGAGCTGGGCCAGGG - Intronic
1182347868 22:29679440-29679462 TGTGGTTGGGATCCGGGATCAGG + Intronic
1183634534 22:39052958-39052980 TATGCTGGGGAGATGGGAAAAGG - Exonic
1184407216 22:44306998-44307020 TGTGGAGGGGACCTGGGATCTGG + Intronic
1184503781 22:44889239-44889261 TGTTCTGGGAATCAGGGATGTGG + Intronic
1184669354 22:46004664-46004686 TGTGCTGGGGGTCCAGGAGAGGG + Intergenic
1184693327 22:46127274-46127296 TGTGCTGGGGAGCCAGGACAGGG - Intergenic
1185114874 22:48926957-48926979 TCTGCTGTGGAGCTGGAATAAGG + Intergenic
950202690 3:11056327-11056349 TGGGCAGGGGCTCTGGGATCAGG + Intergenic
953653206 3:44824384-44824406 GGTGCTGGGGAAATGGGACAGGG - Intronic
954297280 3:49681267-49681289 TGTGCTGGGGAACCTGGAGAAGG - Intronic
955354716 3:58221939-58221961 TTTGCTGGGAATCTGGGGTCAGG - Intergenic
955534872 3:59912256-59912278 TCTATTGGTGATCTGGGATAAGG - Intronic
956088560 3:65639568-65639590 TGTGATGGGGTTTTGAGATAAGG + Intronic
958050961 3:88345580-88345602 TGTCCTGGTGATCTGTGATTAGG + Intergenic
958409679 3:93801295-93801317 TGTGCTGGAAATCTCAGATAGGG + Intergenic
958678558 3:97296334-97296356 TGTGCTCAGGAACTGGGATGGGG + Intronic
959898022 3:111627350-111627372 TGTGCTGGGGAACTGTGTTGTGG - Intronic
960305310 3:116053134-116053156 AGGGCTGTGGATCTGAGATATGG - Intronic
960341824 3:116484218-116484240 TGTGCTGGGGAGGTTGGATGGGG + Intronic
960699620 3:120427471-120427493 TGCCCTGGGGACTTGGGATAGGG + Intronic
960933917 3:122883855-122883877 TCTGCTGGGGATCCTGGAGAGGG - Intergenic
960961194 3:123071663-123071685 TGTGCTGGGGATCCAGGACGAGG + Intronic
961007126 3:123412597-123412619 TGTGCTGGGGAGCTGGGAGTCGG + Intronic
961442183 3:126959699-126959721 TGTGCTGGGCATCTCAGATGAGG + Intronic
961798675 3:129427984-129428006 TGTGCTGAGGGTATGGGATGGGG - Intronic
961912244 3:130330047-130330069 TGTTCTGGGGATCAAGGAGAAGG + Intergenic
962305333 3:134281108-134281130 TGAACTGGGGACCTGGGAGATGG + Intergenic
962368967 3:134805105-134805127 TGAGCTGGGGATGGGGGATTGGG + Intronic
964119003 3:153162846-153162868 GGTGCTGGAGATCCTGGATACGG + Exonic
964890073 3:161523954-161523976 TTTGGTGGGGAGCTGGGATAGGG + Intergenic
965298436 3:166978121-166978143 TGTGCCTTGGATGTGGGATATGG + Intergenic
965596191 3:170413746-170413768 TGTGATGGGGAGCTGAGATGGGG + Intergenic
966090483 3:176129603-176129625 TGTGGTAGGGAACTGGGAAATGG - Intergenic
967085467 3:186091194-186091216 TGTGCTTGTGCTTTGGGATAGGG + Intronic
968235976 3:197030153-197030175 TGCACAGAGGATCTGGGATACGG + Intergenic
968236003 3:197030237-197030259 TGCACAGAGGATCTGGGATACGG + Intergenic
968236030 3:197030321-197030343 TGCACAGAGGATCTGGGATACGG + Intergenic
968236057 3:197030405-197030427 TGCACAGAGGATCTGGGATACGG + Intergenic
968538207 4:1148474-1148496 TGTGCTGGGGGACGGGGATGGGG - Intergenic
969263493 4:6048804-6048826 GGTGCTGGGAAGCTGGGACAAGG + Intronic
969642687 4:8408673-8408695 TGTGCTGGGAAGCAGGGACAAGG - Intronic
972628429 4:40822834-40822856 TGTGGTGGTGATCTGGGTAAGGG + Intronic
972863088 4:43195897-43195919 TGTGCTGGTGGTGTGGAATAAGG + Intergenic
973194291 4:47422107-47422129 TTTGCTGGGGATTTGAGATCAGG - Intronic
973367495 4:49219553-49219575 TGTGCTCTGGATGTGGGATCTGG - Intergenic
973780327 4:54282947-54282969 TGTGCTCTGGACATGGGATATGG - Intronic
976130963 4:81883537-81883559 TGTGTTGAGGACCTGGGATAGGG - Intronic
978829696 4:113069362-113069384 TGTGCTGGAGACCTGGAAGATGG - Intronic
979860425 4:125686639-125686661 TGTGCCCAGGATGTGGGATATGG - Intergenic
979903483 4:126253975-126253997 TGTGTTGGGGTTGTGGTATATGG + Intergenic
980179539 4:129387229-129387251 TGTGCTGGAGTTCTGAGAAAAGG - Intergenic
981516283 4:145613249-145613271 TGTGCCCAGGATGTGGGATATGG + Intergenic
983475301 4:168205510-168205532 TTTGTTGGGGATCAGGGATGAGG - Intergenic
1202765972 4_GL000008v2_random:148842-148864 TGTGCTATGGATATGGGACAAGG - Intergenic
987870877 5:23615060-23615082 TGTGCCCTGGATGTGGGATATGG + Intergenic
989213359 5:38879407-38879429 TGTGGTGGGGAACTGGGGCAAGG + Intronic
989831198 5:45921904-45921926 TGGGGTGGGGATCTGGGGGAGGG - Intergenic
990924209 5:61001181-61001203 ATTGCTGTGGATGTGGGATAGGG - Intronic
993781193 5:92066882-92066904 TGTGCTCTGGATGTGGGACATGG + Intergenic
994073673 5:95628520-95628542 TGTGCTCTGGATGTGGGACATGG - Intergenic
994091735 5:95815639-95815661 TGTGCTGGGGAACTGGGGGAGGG + Intronic
995152031 5:108859591-108859613 AGTTCTGGGTAGCTGGGATATGG - Intronic
996734748 5:126748383-126748405 TGGGCTGGGGATCTGGGGGCGGG - Intergenic
998106460 5:139472068-139472090 TTTGCTGGAGACCTGGGAAAAGG + Intergenic
999038910 5:148385014-148385036 TGTGCTGGGGGAATGGGAAAGGG - Intronic
999389586 5:151180488-151180510 TGTGGAGGGGACCTGGGCTAGGG + Intergenic
1001071219 5:168586953-168586975 TGTTCTAGGGATTAGGGATATGG + Intergenic
1001530730 5:172459738-172459760 TGTCCTGGGGACTTGGGATTTGG - Intergenic
1001562691 5:172679664-172679686 TGTGCTGGGTACCTGGCACACGG - Intronic
1001970944 5:175954441-175954463 GGTGCTGGAGATGTGGGGTACGG + Intronic
1002246498 5:177889336-177889358 GGTGCTGGAGATGTGGGGTACGG - Intergenic
1002373872 5:178774853-178774875 TGTGATGGGGTTCTCGGGTAGGG - Intergenic
1002424995 5:179169627-179169649 GGCCCTGGGGATCTGGGACAGGG - Intronic
1002442070 5:179269756-179269778 TGTGCTGGGGTACAGGGACAGGG - Intronic
1002621664 5:180492716-180492738 AGAGCTGGGGATGTGGGAAATGG - Intergenic
1004285011 6:14313629-14313651 TGTGCTGAGGATCTGGAGTCGGG - Intergenic
1004885719 6:20049990-20050012 GGTCCTGGCCATCTGGGATAGGG + Intergenic
1006373022 6:33657003-33657025 TGAGCTGGGGATCTGGCCTGGGG + Intronic
1006547405 6:34791579-34791601 TGTGCTGGAGAGCTGGGAAGGGG - Intergenic
1006933537 6:37701813-37701835 TCTGCTGGGGGTGTGGGATGAGG - Intergenic
1007053017 6:38852248-38852270 TGGTCTGGGGATCTGGGAAACGG + Intronic
1008099111 6:47372256-47372278 TGTGCCCAGGATATGGGATATGG + Intergenic
1011226680 6:85115745-85115767 TGTGCCGGGTATCTGTGTTAGGG - Intergenic
1011430895 6:87285438-87285460 TGAGCTGCTGATATGGGATATGG - Intronic
1012642280 6:101634088-101634110 TGTGTTGGGGATATGAGATATGG + Intronic
1013386679 6:109638792-109638814 TGGGGTGGGGATCTGGGGGAGGG - Intronic
1014371430 6:120613654-120613676 TGAGGTGGGGTTCTGGGATCTGG - Intergenic
1015179335 6:130345153-130345175 TGTTCTGGGGATCAGGGAATGGG + Intronic
1016673296 6:146733422-146733444 TGTGGTGGGGATTAGGGGTAGGG - Intronic
1016940396 6:149478696-149478718 TGTACTGGGGCCCTGGGAGAAGG - Intronic
1017269550 6:152490748-152490770 GGTGCTGAAGATCTGGGACAGGG + Intronic
1017730999 6:157315572-157315594 TCTGCTGGGTACCTGGGATTGGG - Intronic
1017734377 6:157347855-157347877 TCTGCTGGGTACCTGGGATTGGG - Intergenic
1017776611 6:157685887-157685909 TGTGCTGGCCATGTGGGTTATGG + Intergenic
1018285134 6:162229596-162229618 TGAACTGGTGATCTGGGAGAGGG - Intronic
1019809949 7:3158024-3158046 TGTGCTGGGGAGATGGGAGCAGG - Intronic
1020009268 7:4799580-4799602 TGAGCAGGGCATCTGGGAGAAGG + Intronic
1020086872 7:5315219-5315241 TGTCCCGGGGATCAGGGATGGGG + Intronic
1020125035 7:5528817-5528839 TGTGCTGGGGTCTTGGGATGGGG + Intronic
1022586162 7:31614569-31614591 TGTTCTAAGGATCTGGTATATGG - Intronic
1023677289 7:42643574-42643596 TGTGCATGGGATCTGGGCCAGGG + Intergenic
1023890943 7:44391638-44391660 CGTGCTGGGTATATGGGACACGG + Intronic
1025207439 7:57001934-57001956 TGTCCCGGGGATCAGGGATGGGG - Intergenic
1025664496 7:63574952-63574974 TGTCCCGGGGATCAGGGATGGGG + Intergenic
1027479999 7:78683664-78683686 AGTGCCTGGGATGTGGGATAAGG - Intronic
1029148661 7:98464853-98464875 TGGGCAGGGGCTCTGGGCTAGGG - Intergenic
1029168088 7:98610038-98610060 AGTGCTGGGTATCTGGAAGAGGG - Intergenic
1029712402 7:102306969-102306991 TGTGCTAGGCATCTGTCATAGGG - Intronic
1029887522 7:103888848-103888870 AGTGGTTGGGATCTGGGAAACGG - Intronic
1034265599 7:149779242-149779264 TGCCCTGAGGATCTGGGAGAGGG - Intergenic
1035616885 8:1008806-1008828 TGTGCATGGGAACTGGGAGAGGG + Intergenic
1038048418 8:23786848-23786870 TGCTCTGGGGATCTAGGAGAAGG + Intergenic
1038065798 8:23962610-23962632 TGTGCTGGGGTCCAGTGATAAGG + Intergenic
1038481467 8:27904745-27904767 TCTGCTGGGGCCGTGGGATATGG - Intronic
1039092190 8:33844096-33844118 TGTGTTTGGGATCTGAGATTTGG + Intergenic
1040092336 8:43410745-43410767 AGTCCTGGGGAACTGGGATAAGG + Intergenic
1041103123 8:54416703-54416725 TGTGCTGGGCAGATGGGACATGG - Intergenic
1041787201 8:61648274-61648296 TGGGCTGGGGTTGTGGGGTAGGG - Intronic
1045438854 8:102190465-102190487 TGTGCCCTGGATCTGGGACATGG - Intergenic
1046203543 8:110957477-110957499 TGTGGTGGGGAGGTGGGAGAGGG + Intergenic
1047006087 8:120621868-120621890 TTTGCTGGGGATCGGGGAGGAGG - Intronic
1047661443 8:127041445-127041467 TGGGCTGGGGATGTGGGGAAAGG + Intergenic
1048784400 8:138035081-138035103 TGTGCTGCGGCTCTGGGAAGTGG + Intergenic
1049134858 8:140887226-140887248 AGTGGTGGGGATCTGTGAGAGGG - Intronic
1049292614 8:141812718-141812740 GGTGCTGGGGGTCAGGGAGATGG - Intergenic
1049292687 8:141812922-141812944 TGTGCTGGGGGTCAGGGGTGAGG - Intergenic
1049292705 8:141812966-141812988 GGTGCTGGGGGTCAGGGATGAGG - Intergenic
1049292770 8:141813151-141813173 GGTGCTGGGGGTCAGGGATGAGG - Intergenic
1052225495 9:26080122-26080144 TATGCTGAGTACCTGGGATAAGG - Intergenic
1053168928 9:35864677-35864699 TTTGCTGGGGGACAGGGATAGGG - Intergenic
1053169540 9:35868909-35868931 TGTGCTGGGGATAGGGGAGGGGG + Intergenic
1053175185 9:35917504-35917526 TGAACTGGGGAGCTGGGATTAGG - Intergenic
1053498140 9:38563538-38563560 TGTGCCGTGGATGTGGGACAAGG - Intronic
1055334916 9:75223915-75223937 TGTGCTCTGGATGTGAGATATGG - Intergenic
1056729008 9:89147862-89147884 TGTGCTGGGTGTCTGGGTGATGG - Intronic
1056782699 9:89563244-89563266 TGTGCTGAGGGTCTGGGGTGTGG - Intergenic
1057642295 9:96836090-96836112 TGTGCTGAGGATGTGGGACATGG + Intronic
1057677610 9:97148034-97148056 TGTGCCGTGGATGTGGGACAAGG - Intergenic
1059232278 9:112732009-112732031 TGTGCTTGGGATCTGGCATTTGG + Intergenic
1060035419 9:120251498-120251520 TGTGCTGTGCATCAGGGATACGG + Intergenic
1060104028 9:120862428-120862450 GGAGTTGGGGATCTGGGATCTGG + Intronic
1061365580 9:130171243-130171265 GGTGCTGGGGCCCTGGGGTAGGG - Intergenic
1061419051 9:130463463-130463485 GGTGCTGGGGACCTGGGCTTGGG + Intronic
1061507212 9:131038182-131038204 TGTGCTGGGGTGGTGGGACAAGG - Intronic
1061872394 9:133527919-133527941 TGGCCTGGGGAGCTGGGAGAGGG + Intronic
1061959246 9:133979655-133979677 AGTGGTGGGGCTCTGGGACATGG - Intronic
1062091725 9:134682006-134682028 TGAGCTGGGGATCAGGGGTTCGG - Intronic
1062129850 9:134886352-134886374 GGAGCTGGGGATCTGGGGCAGGG - Intronic
1062217308 9:135396204-135396226 TGTGCCTGGGATCTGGGAGGTGG + Intergenic
1185644000 X:1604106-1604128 TGCTCTGGGCACCTGGGATATGG + Intergenic
1187797606 X:23021419-23021441 TGAACTCTGGATCTGGGATAGGG + Intergenic
1190049951 X:47142173-47142195 TGTGAAGGGGATATGGGATGGGG - Intergenic
1190415035 X:50172560-50172582 TGTGCTTGGGCTGTGGGATGTGG + Intergenic
1190782462 X:53611105-53611127 TGTGCTGGAGATTTGGAGTAAGG - Intronic
1191936243 X:66430132-66430154 TGGGGTGGGGATCTGGGGGAGGG - Intergenic
1192173770 X:68873411-68873433 TGTCCTGGGGCTCTGGCATCTGG - Intergenic
1192773779 X:74221087-74221109 TGTGCTGGGTAGTGGGGATATGG - Intergenic
1196935480 X:120726375-120726397 TATGCTGGGGCTGTGGGATTTGG + Intergenic
1196950100 X:120868460-120868482 TGGGTTGGGGAACTGGGATGGGG + Intergenic
1200049871 X:153423092-153423114 AGCGCTGGGGAACTAGGATAAGG - Intergenic