ID: 1071767648

View in Genome Browser
Species Human (GRCh38)
Location 10:88686776-88686798
Sequence GATGCAGAAGTGGACCCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071767644_1071767648 -5 Left 1071767644 10:88686758-88686780 CCACAAGTCCATAGAGAAGATGC No data
Right 1071767648 10:88686776-88686798 GATGCAGAAGTGGACCCAGGTGG No data
1071767642_1071767648 14 Left 1071767642 10:88686739-88686761 CCTTCACGTTCTCCTTGTTCCAC No data
Right 1071767648 10:88686776-88686798 GATGCAGAAGTGGACCCAGGTGG No data
1071767643_1071767648 2 Left 1071767643 10:88686751-88686773 CCTTGTTCCACAAGTCCATAGAG No data
Right 1071767648 10:88686776-88686798 GATGCAGAAGTGGACCCAGGTGG No data
1071767641_1071767648 22 Left 1071767641 10:88686731-88686753 CCTCATCACCTTCACGTTCTCCT No data
Right 1071767648 10:88686776-88686798 GATGCAGAAGTGGACCCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071767648 Original CRISPR GATGCAGAAGTGGACCCAGG TGG Intergenic
No off target data available for this crispr