ID: 1071770772

View in Genome Browser
Species Human (GRCh38)
Location 10:88727042-88727064
Sequence CAAATTAAACAGAGAGATGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 480
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 452}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071770772_1071770776 24 Left 1071770772 10:88727042-88727064 CCCCCATCTCTCTGTTTAATTTG 0: 1
1: 0
2: 1
3: 26
4: 452
Right 1071770776 10:88727089-88727111 TTTTACATACACTGTTTATCTGG 0: 1
1: 0
2: 2
3: 20
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071770772 Original CRISPR CAAATTAAACAGAGAGATGG GGG (reversed) Intronic
901115717 1:6842126-6842148 CAAAGTAAAGAAAGAAATGGAGG - Intronic
902312097 1:15588877-15588899 CAAACCAAAAAAAGAGATGGTGG + Intronic
902645565 1:17795668-17795690 GAAATTAAACAGAAGGGTGGGGG + Intronic
902825749 1:18972997-18973019 AAAATAAAAAAGAGAGATAGTGG - Intergenic
902837497 1:19056640-19056662 TAAATTAAAAAGAGAGAAAGAGG + Intergenic
903205388 1:21778477-21778499 AATATTAAACACAGACATGGTGG + Intronic
903289090 1:22296619-22296641 GAAAATAAAGACAGAGATGGGGG - Intergenic
905940238 1:41857240-41857262 CAGAGTAAACAGAGAGAAGCCGG - Intronic
906587006 1:46987160-46987182 CAAAATAAATAAAGGGATGGAGG + Intergenic
906818994 1:48909420-48909442 CAGATTAGAGAGAGAGATGTTGG + Intronic
907368955 1:53985962-53985984 AAAGTTAAATAGAGACATGGAGG + Intergenic
907748895 1:57243409-57243431 TAAATGAAACAGAGAGTTGAGGG - Intronic
907959395 1:59264357-59264379 CAAATAGAACAAAAAGATGGAGG + Intergenic
908233295 1:62126967-62126989 CATTTTATACATAGAGATGGAGG + Intronic
908271675 1:62428633-62428655 TGAATTAAACAGAGATATGATGG + Intergenic
908398665 1:63749808-63749830 CAAATAGAACAGAAAGGTGGGGG + Intergenic
908450760 1:64252282-64252304 CAACTGAACCACAGAGATGGTGG - Intronic
910492532 1:87788169-87788191 AAAGCCAAACAGAGAGATGGAGG + Intergenic
912653493 1:111463541-111463563 CAAGTAAAACAGAGAGAGAGAGG + Intergenic
913567201 1:120084332-120084354 TGAATAAAACAGAGAGGTGGAGG + Intergenic
913630932 1:120709213-120709235 TGAATAAAACAGAGAGGTGGAGG - Intergenic
914019488 1:143852902-143852924 CAGATTAATCCGAGAGATGTAGG - Intergenic
914287952 1:146245039-146245061 TGAATAAAACAGAGAGGTGGAGG + Intergenic
914335249 1:146709049-146709071 CAAATTCAACACAGAGATTACGG - Intergenic
914548987 1:148695785-148695807 TGAATAAAACAGAGAGGTGGAGG + Intergenic
914617696 1:149375933-149375955 TGAATAAAACAGAGAGGTGGAGG - Intergenic
914658038 1:149761119-149761141 CAGATTAATCCGAGAGATGTAGG - Intergenic
915258877 1:154660673-154660695 AAAATTATTCATAGAGATGGGGG + Intergenic
916291105 1:163167218-163167240 CCATTTAAAAAGAGAAATGGAGG + Intronic
916539137 1:165735493-165735515 AAAATTAAGCAGAGATTTGGGGG - Intronic
916546348 1:165808691-165808713 CAAATAAAAAAAATAGATGGAGG + Intronic
916699624 1:167277963-167277985 CAAATTTAACAAGGATATGGAGG - Intronic
917861717 1:179152044-179152066 CAATATAAACAAAGACATGGCGG + Intronic
918373500 1:183884820-183884842 GGTATTAAACTGAGAGATGGTGG - Exonic
920286739 1:204885108-204885130 CATATTAAAAAAAAAGATGGGGG - Intronic
920561342 1:206940940-206940962 CAGCTGAAACAGAGAGATGGGGG - Intronic
920572568 1:207028836-207028858 AAGATCAAACAGAGAGTTGGAGG + Intronic
920777878 1:208958112-208958134 CAAAATCAACAGAGAGAGTGAGG - Intergenic
920858382 1:209683513-209683535 AAAAGTAAACAGAGAGTAGGAGG - Intergenic
921398300 1:214692638-214692660 CTAATCAAAGTGAGAGATGGTGG - Intergenic
922004766 1:221518850-221518872 GAAATAAAACTTAGAGATGGTGG - Intergenic
922184304 1:223260463-223260485 CACATGAAAGAGACAGATGGAGG + Intronic
922446822 1:225704849-225704871 CAAACTGAACAGAGAGAGAGAGG + Intergenic
923525925 1:234772721-234772743 CAGAATAAACAAAGAGATGCTGG - Intergenic
924323252 1:242870451-242870473 TGAATTCAACAGAGATATGGTGG + Intergenic
924494576 1:244575024-244575046 CAAATGAGAGAGAGAGATAGAGG - Intronic
924496492 1:244595468-244595490 CAAGTAAAACAGACAGTTGGAGG + Intronic
1062784740 10:254369-254391 AAAATTAAAAAAAGAGATTGTGG + Exonic
1063221044 10:3968208-3968230 CATGTTAAACACAGACATGGAGG + Intergenic
1063281677 10:4636501-4636523 CAATTTAAACATAGAGAAAGAGG - Intergenic
1063473614 10:6309033-6309055 CAAATAAAAAAAAGAGAGGGCGG + Intergenic
1064426264 10:15232327-15232349 ACAATTAAGCAGAGTGATGGTGG - Intronic
1064660353 10:17601560-17601582 GACATTAACTAGAGAGATGGAGG - Intronic
1064765949 10:18671511-18671533 CAAAATAAACTGAGACATGAAGG - Intronic
1065590614 10:27258305-27258327 CCATTTAAAAAAAGAGATGGGGG + Intergenic
1065660385 10:27999544-27999566 CCATTTAAAAAAAGAGATGGGGG - Intergenic
1066069354 10:31790702-31790724 CAAATTAAACAGAAAGAAGTAGG - Intergenic
1068459024 10:57301852-57301874 GAAATAATACAGAGAGATGTGGG - Intergenic
1068926303 10:62542862-62542884 GAAATTAAAAATAGAGGTGGTGG + Intronic
1069411612 10:68160109-68160131 CCATTTAAACTGAGAGATGCCGG + Intronic
1071351115 10:84746318-84746340 CAAATTATACAGAGAGAAAATGG - Intergenic
1071770772 10:88727042-88727064 CAAATTAAACAGAGAGATGGGGG - Intronic
1072503276 10:96040519-96040541 CAAGTGTAACTGAGAGATGGTGG + Intergenic
1072519795 10:96221311-96221333 CAGGCTAAACAGAGAGCTGGAGG - Intronic
1072946614 10:99816264-99816286 CAAACAAAAAACAGAGATGGAGG - Intronic
1073188876 10:101635847-101635869 AAAAAAAAAAAGAGAGATGGAGG + Intronic
1073710359 10:106029902-106029924 CAAATTAACCAGGAAAATGGAGG - Intergenic
1073770054 10:106726104-106726126 CAAAATAAACAGAGAGGAGGAGG - Intronic
1073883931 10:108015913-108015935 AAAAGGAAAAAGAGAGATGGGGG - Intergenic
1074573326 10:114644980-114645002 CAAAATAGGTAGAGAGATGGGGG - Intronic
1075825088 10:125349226-125349248 CACTTTAAACTGGGAGATGGAGG - Intergenic
1079155607 11:17944729-17944751 CTAATCAAACAGAGAGAAGCGGG - Intronic
1079204159 11:18399472-18399494 CAAATTGAAGGGAGAGATGATGG + Exonic
1079473101 11:20799015-20799037 AAAATAAAACAGAGGGATGAGGG + Intronic
1080877926 11:36293638-36293660 AAAAAGAGACAGAGAGATGGGGG + Intergenic
1081191230 11:40104939-40104961 CAGTTTACACAGGGAGATGGAGG - Intergenic
1081785691 11:45745274-45745296 CCAATGAAACGGAGAGAGGGAGG + Intergenic
1083032916 11:59610610-59610632 CAATTTAAACAGAAAGTTGACGG + Intronic
1083797862 11:65028195-65028217 CAATTTATAGAGAGACATGGAGG + Intronic
1085134036 11:74068779-74068801 TAAATAAACCAGAGGGATGGGGG - Intronic
1086139211 11:83475608-83475630 AAAATTGAAGAGAGAGATAGGGG + Intronic
1087330114 11:96770686-96770708 AAAATTAAATAGAGTGATGGTGG - Intergenic
1087779094 11:102284467-102284489 CAAATTAATCAGAAGGATGTAGG - Intergenic
1087823043 11:102732768-102732790 CAATTAAGACAGAGAGATGAAGG - Intergenic
1088064120 11:105695123-105695145 CAAATTAAGCAAAGAGACAGTGG - Intronic
1088766210 11:112981831-112981853 CATCTTAGACATAGAGATGGAGG + Intronic
1088968209 11:114747006-114747028 CAAATTAGCCAAAGAGATAGGGG - Intergenic
1089961698 11:122622523-122622545 CAAAAGAAACAGAGAGAAGTTGG + Intergenic
1091120848 11:133056134-133056156 CAAAACAAACTGGGAGATGGAGG + Intronic
1091601456 12:1920455-1920477 CGAATTATAGAGATAGATGGCGG - Intergenic
1091863972 12:3813720-3813742 CAAATTAAGGAGAGAGGTGAGGG - Intronic
1093251499 12:16810275-16810297 CAAAATGAACACAGAGAGGGCGG - Intergenic
1094038345 12:26095016-26095038 AAAATTAACCACAGAGAAGGAGG + Intergenic
1094348998 12:29502407-29502429 CAAAATAAAGATAGAGATGTAGG + Intronic
1095817573 12:46441254-46441276 AAAAATAAAGAGAGAGAGGGAGG - Intergenic
1095860414 12:46909964-46909986 GAAAATAAAGAGAGAGATAGAGG + Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1097521212 12:60672913-60672935 CAAATTGCAGAGATAGATGGTGG + Intergenic
1098268238 12:68745242-68745264 AAAATTAAAAAGAGAGACTGTGG - Exonic
1100291301 12:93217282-93217304 TAAATTAAAAAGAGAGAGGCTGG + Intergenic
1101626492 12:106448036-106448058 CAAATCAAACAGAAAGGGGGAGG - Intronic
1101893515 12:108736268-108736290 CTCATTAAAAAGAGAGAGGGAGG + Intergenic
1102297114 12:111745822-111745844 AAAAAAAAAGAGAGAGATGGTGG - Intronic
1102707093 12:114891534-114891556 CAAATCCAACAGAGAAATAGAGG + Intergenic
1102784574 12:115594141-115594163 CAAACTAAGCAGACAGAGGGGGG - Intergenic
1103073573 12:117964538-117964560 CAGATTGGACAGAGAGAAGGAGG - Intronic
1103424694 12:120823006-120823028 CAAATTAAACAGACAGGTGTAGG + Intronic
1104056500 12:125234820-125234842 AATATTAAACAAAGAGATAGGGG - Intronic
1104147006 12:126044297-126044319 CATATTGAACAGAGCGAGGGAGG + Intergenic
1105204593 13:18210059-18210081 TAAATTAAACACAAATATGGTGG + Intergenic
1105702820 13:22946053-22946075 TAAACAAAACAGAGAGATGATGG - Intergenic
1106387593 13:29302685-29302707 CAACTGAACCACAGAGATGGTGG - Intronic
1106697260 13:32189399-32189421 CATATTAAAGAGAGAAAAGGTGG + Intronic
1107082917 13:36394258-36394280 GAAATTTAACAGAGAGATCAAGG - Intergenic
1107376149 13:39806909-39806931 CAGATTAGAGAGAGAGAAGGTGG - Intergenic
1107414622 13:40189111-40189133 CTAATTAAACAGACATATGTAGG - Intergenic
1107684845 13:42886531-42886553 AAAATTAAGCATAGAAATGGTGG + Exonic
1111973969 13:94946257-94946279 CAAATTAAATAGAGAGGAGAAGG - Intergenic
1112884311 13:104149578-104149600 CAAAGAAAACAAAGAAATGGAGG + Intergenic
1113080081 13:106510317-106510339 CACATTAAGCAAAGAGATGTTGG + Intronic
1113278476 13:108761760-108761782 CAACAGAAACAGAGAGAAGGTGG - Intronic
1114998640 14:28392894-28392916 CAATGTAAACAGAGAGATACTGG - Intergenic
1115667537 14:35569629-35569651 CAACATAATCAGAGACATGGAGG - Intronic
1115802324 14:37009087-37009109 AAGAATAAAGAGAGAGATGGTGG - Intronic
1116101745 14:40446955-40446977 CAAAATAAAAATTGAGATGGGGG + Intergenic
1116372829 14:44157958-44157980 GAAAGGAAACAGAGAGATGTTGG + Intergenic
1116462893 14:45198052-45198074 CAAATTAAAAAGAAGGCTGGTGG - Intronic
1116550240 14:46228256-46228278 CAGATTAAACAAAGAAATTGTGG - Intergenic
1116913798 14:50500798-50500820 CAAATAAAAGAGAGAAATCGAGG + Intronic
1117667005 14:58066608-58066630 AAAAATAAACAGGGAGAAGGGGG + Intronic
1117688732 14:58282832-58282854 TAAATAAAACAGTGAGATAGAGG + Intronic
1117696792 14:58373415-58373437 CATATTAAACACAGAAAAGGAGG - Exonic
1119322584 14:73740526-73740548 CAAATAACACAGACAGATGCAGG - Intronic
1120499061 14:85271349-85271371 CAGAAGGAACAGAGAGATGGTGG + Intergenic
1120614916 14:86691671-86691693 CCAATTAAAGTGAGAGATGTTGG + Intergenic
1121122409 14:91384262-91384284 AAAAAAAAAAAGAGAGATGGGGG - Intronic
1121189030 14:92007574-92007596 TAAACTAAACACAGAAATGGTGG - Intronic
1122250221 14:100433667-100433689 CAAAATAAACAGACTAATGGGGG - Intronic
1125968220 15:43891274-43891296 CAAATAAAACAGAGAGGGGCAGG + Intronic
1126945788 15:53818395-53818417 CAAAGTAAACGGAGAGAAAGAGG + Intergenic
1127526131 15:59793231-59793253 AAAATTAAAGAGAGAGAGAGAGG + Intergenic
1128307251 15:66607078-66607100 CATATTAGACAATGAGATGGAGG - Intronic
1128431819 15:67603231-67603253 CAACATTAACAGAGTGATGGGGG - Intronic
1128461469 15:67871100-67871122 CAAATTAAACAGGGATAGGAGGG + Intergenic
1128506507 15:68276972-68276994 CAAATGAAATAGAATGATGGGGG - Intergenic
1128811308 15:70574834-70574856 CAAATTGGACAGAGTGTTGGAGG - Intergenic
1128856909 15:71025661-71025683 AAAATAAAACAAAGGGATGGAGG + Intronic
1130128966 15:81120197-81120219 CAAATTAATCAGACACATGAAGG + Intronic
1131160846 15:90103780-90103802 TTAATTAAAAATAGAGATGGGGG + Intergenic
1132070066 15:98768529-98768551 CACTTTAACCAGAGAGTTGGAGG + Intronic
1132999893 16:2844019-2844041 CAAAGAAAAAAAAGAGATGGAGG + Intergenic
1133307395 16:4819181-4819203 TTATTTAAAAAGAGAGATGGGGG + Intronic
1134904411 16:17967729-17967751 CAATTAACACAGAGATATGGGGG + Intergenic
1135592918 16:23717584-23717606 CAAAATAGAGAGAGAGATAGCGG + Intergenic
1136337322 16:29618672-29618694 GAAATTAAAAAGAGAGAATGAGG - Intergenic
1138574629 16:57899789-57899811 CAAACTAAACAGAAACATGGAGG - Intronic
1138999478 16:62492176-62492198 ATAATTAAACAAACAGATGGTGG + Intergenic
1139998376 16:71002190-71002212 CAAATTCAACATAGAGATTACGG + Intronic
1140858212 16:78996566-78996588 AAAATTACAGTGAGAGATGGTGG + Intronic
1141524177 16:84600886-84600908 CAAATTAAACCGAGAGCTAAAGG + Intronic
1143122848 17:4619938-4619960 CAAATTAAAAAGTCAAATGGAGG + Intergenic
1143355968 17:6328833-6328855 CAGATTCAAGAGATAGATGGTGG + Intergenic
1143815433 17:9508658-9508680 GAAATAACACAGAAAGATGGGGG + Intronic
1146638530 17:34523556-34523578 CCCCTTAACCAGAGAGATGGCGG + Intergenic
1147499405 17:40948470-40948492 CAAAGGAAACAGAGAGAGGGAGG - Intergenic
1147554939 17:41472323-41472345 CAAAATAGGGAGAGAGATGGGGG + Intergenic
1147844821 17:43397730-43397752 TGAATGAGACAGAGAGATGGTGG - Intergenic
1148014207 17:44509597-44509619 CAAAAGAAAGAGAGAGAGGGGGG + Intergenic
1148931079 17:51127849-51127871 CAAAGTATACTGAGAGGTGGTGG - Intergenic
1149504877 17:57185893-57185915 CAAAAAAAAAAGAGAGATGGGGG + Intergenic
1149662548 17:58342512-58342534 AAAATTAGCCAAAGAGATGGAGG - Intergenic
1150060280 17:62062825-62062847 GAAATTAAGAAGAGAGGTGGTGG + Intronic
1151693079 17:75699164-75699186 AAAATAAAACAAAGAGATGGGGG - Intronic
1153139104 18:1952220-1952242 CAGATAAAAGAGAGAGAGGGAGG - Intergenic
1153357939 18:4158691-4158713 CAAATTAAATTAAGAGCTGGGGG - Intronic
1153669025 18:7392778-7392800 CAAAATAAAAAAGGAGATGGGGG - Intergenic
1155112797 18:22733130-22733152 TAAAAAAAAGAGAGAGATGGAGG - Intergenic
1155711716 18:28888668-28888690 AATATTAAAGAGAGAGAAGGGGG + Intergenic
1155945146 18:31840356-31840378 CAAAATAAATAGAGAGACAGAGG + Intronic
1156531324 18:37819723-37819745 TAAATAAAACAAAGAGAGGGAGG + Intergenic
1156825955 18:41430197-41430219 CAAAATAAACAGAGATATTTGGG + Intergenic
1157013428 18:43680606-43680628 CAATTTGAACAGAGAGAAAGAGG + Intergenic
1157104719 18:44763128-44763150 AAAATTAAATAGAGATAGGGAGG + Intronic
1157195882 18:45619817-45619839 CAAATTGAAGGGAGAGAGGGTGG - Intronic
1157636772 18:49164715-49164737 TAAATTAAACAGAGATTTTGGGG + Intronic
1157830484 18:50852718-50852740 CAAGTTTGACAGAGAGAGGGAGG - Intergenic
1158237046 18:55328500-55328522 CAATGTAAAAACAGAGATGGAGG + Intronic
1158342828 18:56485140-56485162 TAAATTAAACATAAAGCTGGGGG + Intergenic
1159604407 18:70460146-70460168 CAAAATGAACAGCGAGTTGGTGG + Intergenic
1161303859 19:3556470-3556492 GCAGTTAAACAGACAGATGGGGG + Intronic
1161709584 19:5840464-5840486 CAAAAAAAAGAGAGAGATAGGGG - Intergenic
1163600112 19:18243936-18243958 CACATGAAACAGGGAGTTGGAGG - Intronic
1164866398 19:31607705-31607727 TCAATTAAACACAGTGATGGAGG + Intergenic
1165481237 19:36065764-36065786 CAAAGCACACAGAGAAATGGGGG - Intronic
1165584658 19:36903513-36903535 CAAATTATAAAGAAAGATGTGGG - Intronic
1165988802 19:39793821-39793843 CAAAATAATCAGAGATATTGAGG - Intergenic
1166226388 19:41398180-41398202 CGACTTGAAGAGAGAGATGGGGG + Intronic
1166872412 19:45878930-45878952 CAGAGTAGACAGAGAGACGGTGG - Intergenic
1167204685 19:48093087-48093109 CAGATTTAGCAAAGAGATGGTGG + Intronic
1167635726 19:50654277-50654299 GAAAGAAAAGAGAGAGATGGAGG - Intronic
1168676543 19:58282027-58282049 CACATGAACCAGGGAGATGGAGG + Intronic
926798053 2:16635013-16635035 CAAGTCAAACAGTGAGTTGGCGG - Intronic
928724939 2:34161525-34161547 CAGATGAAACAGAGAGAATGTGG + Intergenic
928865526 2:35913336-35913358 CAAATCAATCAAAGTGATGGAGG + Intergenic
928938159 2:36702094-36702116 AATGTTAAACAGAGAGATGAAGG + Intronic
929322091 2:40556524-40556546 CAAATGAACCAGAGAGAAAGGGG + Intronic
929615811 2:43306371-43306393 TAAATTAAACAGGGTCATGGTGG - Intronic
930388720 2:50732830-50732852 CAAATTAAACTAAGAAATAGAGG + Intronic
932131006 2:69187188-69187210 TAAATTAGACGGGGAGATGGTGG - Intronic
932291315 2:70582452-70582474 CAAGATTAAGAGAGAGATGGGGG + Intergenic
932463222 2:71896774-71896796 CAAATTACACAGTGAGCAGGTGG - Intergenic
932625815 2:73295032-73295054 CAAATTAAATAAATACATGGGGG + Intergenic
932727843 2:74194830-74194852 CAAATTTTGCAGAGGGATGGAGG + Intergenic
933246594 2:79982854-79982876 CAAATTTGAAAGAGAGATAGAGG - Intronic
933994668 2:87659515-87659537 GAAAATAAACAGAGAGAAAGAGG - Intergenic
934474353 2:94583725-94583747 AAAAATAAAAATAGAGATGGAGG + Intergenic
935216742 2:100980928-100980950 GAAATCACACAGCGAGATGGTGG - Intronic
935618961 2:105112364-105112386 CAACTTAAATAGAGTGATCGCGG + Intergenic
935944514 2:108273213-108273235 AAAAAAAAAAAGAGAGATGGGGG + Intergenic
935965122 2:108465186-108465208 CAAATTCAACAGAGAAGTGACGG - Intronic
936273039 2:111066554-111066576 GAAATTATACAGAGATATGTTGG - Intronic
936299188 2:111291398-111291420 GAAAATAAACAGAGAGAAAGAGG + Intergenic
936728481 2:115352854-115352876 CATAGTAAAGAGAGAGATGTAGG - Intronic
936976468 2:118226100-118226122 CTAAATAAACAGAGACCTGGAGG - Intergenic
936983928 2:118290280-118290302 AAATTTAAAAACAGAGATGGGGG - Intergenic
937235063 2:120426164-120426186 CAAAAAAAAGACAGAGATGGAGG - Intergenic
937800970 2:126079841-126079863 CAGAAAAAACAGAGAGAAGGAGG + Intergenic
938783168 2:134603573-134603595 CAAATTAAAAAGCCATATGGCGG + Intronic
939386314 2:141503585-141503607 CAAATTATACAGATAGAAGGAGG - Intronic
939702374 2:145409325-145409347 CAAATTACACATAGAGAGTGTGG + Intergenic
940939289 2:159539532-159539554 CAAATTAAACATGGTGGTGGAGG + Intronic
941137813 2:161739232-161739254 CAGATTAACCAGAAAAATGGAGG + Intronic
941213814 2:162679798-162679820 CAAGTAAAACAGAGAAATGTGGG - Intronic
941377248 2:164746879-164746901 AAAGTAAAGCAGAGAGATGGGGG - Intronic
941805155 2:169704857-169704879 AAAATGAAACAGCTAGATGGGGG + Intronic
941852036 2:170193904-170193926 CAAATTAAACAGAAAAATAAGGG - Intronic
941856423 2:170235539-170235561 CCAACTAAGCAGAGAGATGTTGG - Intronic
941873797 2:170412906-170412928 CAAATTAAATAGAAAGAAGTGGG - Intronic
941874293 2:170417727-170417749 AAACTTAAACACAGACATGGAGG - Intronic
944601304 2:201306228-201306250 CAAAAGAAAGAGAGAGAAGGGGG + Intronic
945387898 2:209225419-209225441 AAAATGAGACAGAGATATGGTGG - Intergenic
945491527 2:210461363-210461385 CAAATTAAACACTGAAATGCTGG + Intronic
945686563 2:212977859-212977881 CAAATTACAAAGAGGGAGGGAGG - Intergenic
946822636 2:223646216-223646238 CAAAATAAACAGGGAGCTGGAGG + Intergenic
947336455 2:229090587-229090609 AAAATTACTCAGAGAGCTGGAGG - Intronic
1170005826 20:11667928-11667950 CCAATTAAAAAGAAAGCTGGAGG - Intergenic
1170229968 20:14035765-14035787 AAAATTATTCAGAGAAATGGAGG + Intronic
1174202369 20:48816038-48816060 AAAAAAAAACAGAGAGATGCTGG + Intronic
1174684806 20:52444202-52444224 CAAATTAAAGACAGATATTGAGG - Intergenic
1174806907 20:53612158-53612180 AAGATTAAAAATAGAGATGGGGG - Intergenic
1175684744 20:61020482-61020504 TAAATTAAAAAGACACATGGTGG + Intergenic
1176839819 21:13829399-13829421 TCAATGAAACAGAGAGATGAAGG - Intergenic
1177492972 21:21852608-21852630 CAAACTAAACATAGAGAAGAAGG - Intergenic
1177763228 21:25426390-25426412 CAAATAAAACAGATACCTGGAGG + Intergenic
1178245324 21:30945091-30945113 CAAAATAAAAAAAAAGATGGTGG + Intergenic
1178317330 21:31577721-31577743 CAAATGAGAAAAAGAGATGGCGG + Intergenic
1178771961 21:35513371-35513393 CAAATATAACAGATAGATTGTGG - Intronic
1178796324 21:35747667-35747689 CAAAATAAAAAATGAGATGGTGG - Intronic
1178899333 21:36586564-36586586 GAAAAAAAAAAGAGAGATGGGGG + Intergenic
1181277626 22:21696520-21696542 CACATTTAACAGAAAAATGGGGG - Intronic
1181410024 22:22712234-22712256 CAAAGGAAACAGAGAGAGGAGGG - Intergenic
1181566327 22:23740915-23740937 AAAATTAGAAAGAGAGAGGGAGG + Intergenic
1182078033 22:27508304-27508326 CAAATTAGTCAGAGAGGAGGGGG + Intergenic
1182987039 22:34729633-34729655 CAAAGTAGAGAGTGAGATGGTGG + Intergenic
1183130435 22:35829560-35829582 AAAAAGAAACAGAGAGAGGGAGG + Intronic
949792162 3:7804690-7804712 AAAAATATACAAAGAGATGGAGG + Intergenic
949945984 3:9190636-9190658 CTAATGAAACAAAAAGATGGAGG - Intronic
950390163 3:12690289-12690311 CAAAATAAACAAATAAATGGTGG - Intergenic
951154826 3:19338411-19338433 AAAATTATACAGAGTGGTGGTGG - Intronic
952070683 3:29631803-29631825 CAAATTAAACAGAAAAGGGGAGG + Intronic
954173709 3:48826088-48826110 AAAATTATTCATAGAGATGGGGG - Intronic
956126235 3:66013459-66013481 CAAATTAAAGAAAAAGATAGAGG + Intronic
957235538 3:77584132-77584154 CATATGAAAGAGGGAGATGGTGG - Intronic
957239846 3:77644655-77644677 TAAATTGAACAGAAACATGGAGG - Intronic
958081016 3:88746540-88746562 CAGATGAAAAGGAGAGATGGAGG - Intergenic
958163694 3:89851680-89851702 CAACATAAACATAGAAATGGAGG + Intergenic
958488119 3:94738114-94738136 CTAAATCAAAAGAGAGATGGTGG + Intergenic
959235295 3:103713642-103713664 CAAATAAAAAACAGATATGGTGG + Intergenic
961106099 3:124242912-124242934 CAAATTATACCAAGAGATGTAGG + Intronic
961515045 3:127427097-127427119 CAATTAAAGCAGAGAGATCGAGG + Intergenic
962468626 3:135685206-135685228 TAAATTAAACAAAGAGATAAAGG + Intergenic
963277486 3:143347403-143347425 CAAAGGAAACAGATAAATGGAGG + Intronic
964592383 3:158379064-158379086 CAAATTCAGGTGAGAGATGGTGG - Intronic
964599569 3:158482573-158482595 CAAATAAAACAAAGGGATGGAGG - Intronic
964625215 3:158752161-158752183 CAAATAAAACAGAAAGACAGAGG + Intronic
965813960 3:172617991-172618013 TAATTCAAACAGAGATATGGTGG + Intergenic
965933063 3:174070880-174070902 CAAATTTTTCATAGAGATGGGGG - Intronic
966089688 3:176117975-176117997 CACTTTAACCAGGGAGATGGAGG + Intergenic
966499570 3:180624364-180624386 CAATTAAAACATATAGATGGTGG - Intronic
967313432 3:188128045-188128067 CAAAACAAAAAGAAAGATGGGGG + Intergenic
967445892 3:189566105-189566127 AAAACTAAACAAAGAGATAGTGG + Intergenic
967668384 3:192202218-192202240 CAAAAGAAACAGACAGATTGAGG + Intronic
968057314 3:195702149-195702171 AAAATTAAAAAGAGAGAGAGAGG - Intergenic
968348977 3:198036507-198036529 GAAATGAGACAGAGAGATGTGGG + Intronic
969035991 4:4254410-4254432 CTATTTAAGCAGCGAGATGGAGG + Intergenic
969179614 4:5427922-5427944 CAAAGTAAGCAGAGAGAAGGAGG - Intronic
969909934 4:10435003-10435025 GAAATTAAAAATAAAGATGGGGG - Intergenic
969924326 4:10571999-10572021 CAAATCAAACAGTGACTTGGAGG + Intronic
970093086 4:12431354-12431376 TAATTTAAAGAGAGTGATGGGGG + Intergenic
971861166 4:32108072-32108094 CAAAAGAAAGAGAGAGAGGGAGG + Intergenic
971957933 4:33446642-33446664 AACATTAAAGAGAGAGAGGGAGG + Intergenic
972502748 4:39693667-39693689 AAAAAAAAAGAGAGAGATGGGGG + Intergenic
974014295 4:56634822-56634844 CAAGTTAAAAAGCGAGATGCAGG + Intergenic
974819203 4:67044951-67044973 CAAATTAAAAAGATATATGTAGG + Intergenic
975177480 4:71304437-71304459 AAAATCAAACAAAAAGATGGCGG - Intronic
976890212 4:90037711-90037733 CAAATCAAAGAGAGAAGTGGAGG - Intergenic
978305730 4:107326521-107326543 TAAATTTAACAGAGAAATGCAGG + Intergenic
978400339 4:108324301-108324323 CGAATTAAACAGAGATATGATGG - Intergenic
978869432 4:113557331-113557353 CAAATTAAGCGGAGACATGAAGG - Intronic
979397993 4:120211726-120211748 CAAATAAAAGAAAGAGAGGGAGG - Intergenic
979441704 4:120757924-120757946 CAGATCAAGGAGAGAGATGGAGG - Intronic
981075320 4:140585579-140585601 ATAACTAAACAGAGGGATGGAGG - Intergenic
981988218 4:150883570-150883592 TGATTTAAAAAGAGAGATGGTGG - Intronic
982434099 4:155362386-155362408 AAAAATAAATAGAGAGGTGGTGG - Intronic
982964007 4:161879149-161879171 CAGATGAGACAGAGAGATGTTGG - Intronic
983621522 4:169766334-169766356 CAAATTATACAGCTAAATGGTGG + Intergenic
983772174 4:171564372-171564394 AACATTAAACAGAGAAAAGGAGG + Intergenic
984573539 4:181421863-181421885 GAAATTGAAAAGAGAGAGGGTGG - Intergenic
985891234 5:2716647-2716669 CAAATTAAACACACAGATGGAGG - Intergenic
987045855 5:14107329-14107351 CAAAACAAAAAGAGATATGGTGG - Intergenic
987194739 5:15514959-15514981 CAAACTGGACAGAGAGAAGGTGG - Intronic
987456464 5:18152691-18152713 GAAAAAAAAGAGAGAGATGGAGG - Intergenic
987729872 5:21755502-21755524 TAAATTGAGGAGAGAGATGGAGG + Intronic
988109041 5:26791463-26791485 AAAATTAAACAGAGAACTTGGGG + Intergenic
988410643 5:30881392-30881414 CAAAGTGAACACAAAGATGGAGG - Intergenic
988578551 5:32448964-32448986 AAAATGAAGCAGAGAGATTGTGG - Intergenic
989011128 5:36875056-36875078 CATATTAAAGACAGAAATGGGGG + Intergenic
989663810 5:43827908-43827930 AAAAATAAACAAAGAAATGGTGG - Intergenic
989715172 5:44454410-44454432 CAGTTTTAACAGAGAGAGGGAGG + Intergenic
990631579 5:57676118-57676140 CAAAATAAATAGAGGGATGGGGG + Intergenic
990741486 5:58916761-58916783 CAAATTAACCACAGACTTGGTGG - Intergenic
990774393 5:59288501-59288523 AAAGTTAGAAAGAGAGATGGGGG + Intronic
990908450 5:60828302-60828324 TAAATTATGCAGAGACATGGAGG + Intronic
992345546 5:75873115-75873137 CAAATTAAAAAGAGATACGTTGG + Intergenic
994002949 5:94803024-94803046 CTTATTAAAAGGAGAGATGGGGG - Intronic
994435575 5:99727009-99727031 CAAATTCAATAGAAAGAAGGAGG - Intergenic
996382898 5:122880075-122880097 CAAAGTAAACAGAAGGTTGGAGG - Intronic
996568284 5:124905066-124905088 CCCATTAAACAGAGAGGAGGAGG - Intergenic
996957142 5:129197012-129197034 CATTTTAAATAGAGAGATGAAGG - Intergenic
997642008 5:135455497-135455519 CAAGCTAAGCAGAGAGGTGGGGG + Intergenic
998327315 5:141292793-141292815 CAAATTAAATAGATAGATATAGG + Intergenic
998424751 5:142017001-142017023 CTTCTTACACAGAGAGATGGGGG - Intergenic
999184781 5:149698931-149698953 CAAAGTAATGAGAGAGATGAGGG - Intergenic
1000613809 5:163405843-163405865 AAAATTCAGCAGAGACATGGGGG + Intergenic
1000729546 5:164815312-164815334 CAAATAGAACAAAGAAATGGAGG - Intergenic
1002373275 5:178771198-178771220 CAATTTAAACAGACAGTGGGAGG - Intergenic
1003152838 6:3567058-3567080 CAACCTACAGAGAGAGATGGTGG - Intergenic
1003441752 6:6149360-6149382 AAACTTAAAAAGAGAGATTGAGG + Intronic
1003811464 6:9787285-9787307 AAAATTACACATAGAGATAGAGG + Intronic
1004074234 6:12330333-12330355 TAAAAGAAACAGAGAGAAGGGGG - Intergenic
1004995755 6:21191109-21191131 CAAATTAAACAAAGACATCAGGG - Intronic
1005909609 6:30297042-30297064 CGAATGAAAAAGAGGGATGGGGG - Intergenic
1006277044 6:33013333-33013355 AAAACAAAACAGAAAGATGGAGG - Intergenic
1006773148 6:36570756-36570778 AAAAAAAAAGAGAGAGATGGGGG - Intergenic
1006936857 6:37724569-37724591 CAGATAGAACAGAGAGAGGGAGG + Intergenic
1007122354 6:39393513-39393535 AAAAATAAACACAAAGATGGGGG + Intronic
1007494583 6:42250879-42250901 GCAATTAAAAAGAGACATGGAGG + Intronic
1008756497 6:54801230-54801252 AAAATTAATCAAAGAGATTGAGG + Intergenic
1009451678 6:63808456-63808478 TAGATTAGACAGAGAGCTGGAGG + Intronic
1010313097 6:74411528-74411550 CAAATTAAAGAGTAAGATGAAGG - Intergenic
1010538788 6:77064391-77064413 GAAATTCAACAGAGAAATGATGG - Intergenic
1011731974 6:90274049-90274071 GAGATTAAACAGACAGATAGGGG + Intronic
1011859725 6:91739585-91739607 CCAATAGAACAGAAAGATGGAGG + Intergenic
1011898700 6:92264539-92264561 CAGATTAAATAGAGAGGTCGGGG - Intergenic
1012431932 6:99172935-99172957 CAAAACAAACAGAGACATGTGGG - Intergenic
1012701001 6:102457745-102457767 CAGGTTAAACACAGAGAAGGAGG - Intergenic
1013010298 6:106114422-106114444 AAAATTAAACTGAGAGAGGGAGG + Intergenic
1013059687 6:106621007-106621029 CAAATTGAATAGAGAGAAAGGGG - Intronic
1013175140 6:107670130-107670152 TAAAAAAAAAAGAGAGATGGGGG + Intergenic
1015560831 6:134513653-134513675 CAAATTAGAAATAAAGATGGGGG + Intergenic
1016736898 6:147489059-147489081 CAGAAGAAACGGAGAGATGGAGG - Intergenic
1016745942 6:147580436-147580458 CAAATAAAACAAAGAGAGGTAGG - Intronic
1017122329 6:151036241-151036263 AAAAATAAAAATAGAGATGGAGG - Intronic
1017391735 6:153947204-153947226 CAAATTCCAAGGAGAGATGGAGG + Intergenic
1017655963 6:156630326-156630348 AAAATTAACCAGAGTGGTGGTGG + Intergenic
1020556559 7:9677597-9677619 GTAAGTATACAGAGAGATGGTGG + Intergenic
1022426937 7:30278026-30278048 CAAATTCAACATACAGCTGGAGG + Intergenic
1022491313 7:30821719-30821741 CAAATAAATAAGAGAAATGGAGG - Intronic
1023915468 7:44585448-44585470 CAAAGTAACCAGAGAGATGAGGG - Intergenic
1024199838 7:47095524-47095546 CAAATTGAACACAGAGCTGCTGG + Intergenic
1026586840 7:71662303-71662325 ATAGATAAACAGAGAGATGGGGG - Intronic
1028847234 7:95495804-95495826 CAAACAAGACAGAGAGATGGAGG - Exonic
1029689995 7:102174962-102174984 CAAAAAAAACAGATAGAGGGAGG + Intronic
1030419660 7:109292580-109292602 CAAATTAACCAGAGAGAATAGGG - Intergenic
1030711528 7:112755920-112755942 CAAATGAAAGAGAAAGATGTGGG + Intergenic
1030720521 7:112865275-112865297 CAAAAAAAAGAGAGAGATGGGGG - Intronic
1031654868 7:124342273-124342295 AAAATTAGGGAGAGAGATGGAGG + Intergenic
1031786066 7:126034426-126034448 CAAATTTCACAGTAAGATGGGGG + Intergenic
1031927620 7:127652772-127652794 CAAAATGAACAGAAAGACGGGGG - Intronic
1032196870 7:129794492-129794514 AAAGTTGTACAGAGAGATGGTGG - Intergenic
1032401941 7:131629850-131629872 CAAAAGAAACAGATACATGGTGG + Intergenic
1032629340 7:133630413-133630435 TAGATAAAACAGAGAGAGGGAGG - Intronic
1033259296 7:139828629-139828651 TAAAGTGGACAGAGAGATGGAGG - Intronic
1033985815 7:147224106-147224128 CAGATTAAAGAGACAGATGAGGG - Intronic
1034704731 7:153130366-153130388 GAAAATAAAGAGAGAAATGGAGG - Intergenic
1036293977 8:7520450-7520472 CAGATTTAACAGGGAAATGGGGG + Intergenic
1036328585 8:7800541-7800563 CAGATTTAACAGGGAAATGGGGG - Intergenic
1036428618 8:8669127-8669149 CAAAATGAACAGAGGGTTGGTGG - Intergenic
1037351769 8:17967071-17967093 CAAAATAAACTGGGAGAAGGAGG - Exonic
1037411154 8:18599248-18599270 CAAATTCAACACATATATGGGGG + Intronic
1038676652 8:29628862-29628884 CAAAATAAAAACAGAGATCGAGG - Intergenic
1039654933 8:39394022-39394044 CACAAAAAAGAGAGAGATGGGGG - Intergenic
1039742764 8:40397428-40397450 CAATTAGAACAGAGAGAGGGTGG + Intergenic
1041142562 8:54838738-54838760 CAAATACAACAGAGAGATTCAGG - Intergenic
1041696714 8:60743508-60743530 CAATATAAAAGGAGAGATGGAGG - Intronic
1041945881 8:63442390-63442412 AAAAGTAAACAGAGGCATGGAGG - Intergenic
1043012575 8:74899805-74899827 AGAAGTAAACAGAGAAATGGAGG - Intergenic
1043029550 8:75116127-75116149 GAAATTAAAGAGAGAGGTAGAGG - Intergenic
1043142367 8:76605846-76605868 AAAATAGATCAGAGAGATGGGGG + Intergenic
1043417018 8:80061530-80061552 AAAATTAACCAGGCAGATGGTGG + Intronic
1043812413 8:84757616-84757638 AGAATTAAAAAGAGGGATGGAGG + Intronic
1044870975 8:96619632-96619654 CAAATTTCACAGAGAAATGGAGG - Intergenic
1045037756 8:98189487-98189509 CCAATTTAACAGTGATATGGTGG - Intergenic
1045394749 8:101749800-101749822 CAGATGAAAGAGAGAGATAGAGG - Intronic
1045821085 8:106338873-106338895 TAAATTAAAGAGAGAGAGAGTGG - Intronic
1046027511 8:108743425-108743447 GAAATTAAACAGAAAAAAGGTGG + Intronic
1046480227 8:114807560-114807582 AAAATAAAACTGAAAGATGGAGG - Intergenic
1048406540 8:134128313-134128335 CCAATTAAGGAGAGAGAAGGCGG - Intergenic
1050038524 9:1463034-1463056 CAAATTACACAGGGAAAAGGAGG + Intergenic
1050971703 9:11885109-11885131 CAAATTAAACAAAGTAGTGGTGG + Intergenic
1051227934 9:14922145-14922167 CAAATTGAAGGGAGAGATGATGG - Intergenic
1051993830 9:23189002-23189024 CAAAGTAAAAAGTAAGATGGGGG - Intergenic
1052062898 9:23983016-23983038 CAATTTAAAAATAGAGATGTTGG + Intergenic
1052226668 9:26097245-26097267 CAAATTAACCAGAGTAATGGAGG + Intergenic
1052795948 9:32923635-32923657 CAAATCAAACAGAATGATGTTGG + Intergenic
1052918376 9:33941989-33942011 CTAATTTAACTGAGAGATAGGGG + Intronic
1053560214 9:39184719-39184741 AAAATTAAAGAGAGAGATCAAGG - Intronic
1053683719 9:40502384-40502406 AAAAATAAAAATAGAGATGGAGG - Intergenic
1053933698 9:43130696-43130718 AAAAATAAAAATAGAGATGGAGG - Intergenic
1054136904 9:61434236-61434258 AAAATTAAAGAGAGAGATCAAGG + Intergenic
1054279997 9:63122543-63122565 AAAAATAAAAATAGAGATGGAGG + Intergenic
1054296820 9:63337875-63337897 AAAAATAAAAATAGAGATGGAGG - Intergenic
1054380328 9:64484338-64484360 TCAATGAAACAGAGAGATGAAGG + Intergenic
1054394837 9:64642381-64642403 AAAAATAAAAATAGAGATGGAGG - Intergenic
1054429485 9:65147581-65147603 AAAAATAAAAATAGAGATGGAGG - Intergenic
1054500897 9:65873950-65873972 AAAAATAAAAATAGAGATGGAGG + Intergenic
1055712681 9:79081599-79081621 CAGATGAAACAGAGAGAAGGGGG + Intergenic
1055923934 9:81490646-81490668 CAAATTTGGTAGAGAGATGGTGG - Intergenic
1056332453 9:85532391-85532413 TAAATTAAAAAAAGAGATGTAGG - Intergenic
1056918325 9:90763395-90763417 CAAATTCAAGAGTGAGCTGGTGG + Intergenic
1057779768 9:98040138-98040160 CAAAGGAAAGAGAGAGATGCCGG - Intergenic
1058224743 9:102346264-102346286 CAAAATAAATGGAGAGTTGGTGG + Intergenic
1058664377 9:107296936-107296958 CAAATGAACCAGGGAGCTGGAGG - Intronic
1059076350 9:111197432-111197454 CAACTGAACCACAGAGATGGTGG - Intergenic
1059564389 9:115368838-115368860 CAAATGGAACAAAGAGATGATGG - Intronic
1060374413 9:123105803-123105825 CAGATTAGACAGAGAGCAGGTGG + Intergenic
1061584409 9:131556628-131556650 AAAAAAAAAGAGAGAGATGGTGG - Intergenic
1062228482 9:135467320-135467342 CAAAAAAAAAAGAGAGATGCAGG - Intergenic
1185562541 X:1070768-1070790 AAAAAGAAAGAGAGAGATGGAGG + Intergenic
1185752547 X:2625415-2625437 AAAAATAAACAGAAAGATAGTGG - Intergenic
1185911331 X:3983706-3983728 AACATAAAACAGAGAGATGCAGG - Intergenic
1185986805 X:4844380-4844402 CACATCAGGCAGAGAGATGGAGG - Intergenic
1187728815 X:22232652-22232674 CAAAATAAATAAAGGGATGGAGG - Intronic
1187741832 X:22364430-22364452 CAAAATAGACAGAGAGATGTTGG - Intergenic
1187807195 X:23133558-23133580 CAATTTAAAGAGACAGAGGGAGG + Intergenic
1188528921 X:31115898-31115920 AAAATGAAACAAAGAGATGGTGG + Intronic
1190104552 X:47550035-47550057 CAAAATACACAGAGACTTGGGGG + Intergenic
1191952520 X:66608242-66608264 CAGAAAAAACAGGGAGATGGGGG + Intronic
1192965245 X:76170351-76170373 CCAATCAAACAGGGAGATGGAGG - Intergenic
1193968883 X:88025443-88025465 CAAAATAAACAGAGAAGTGTTGG + Intergenic
1194565720 X:95485591-95485613 TAAATTAAACAGAGATATAATGG - Intergenic
1194756840 X:97747671-97747693 CAGGTTAATCAGGGAGATGGTGG + Intergenic
1195274863 X:103272163-103272185 CATATTATTCAGAAAGATGGAGG + Intergenic
1196226405 X:113172566-113172588 CAGATAAAACAAAAAGATGGAGG + Intergenic
1197086379 X:122480952-122480974 CAAATTAAACCCAGAGATAAAGG + Intergenic
1197714132 X:129694074-129694096 AAAATAAAATAGAGAGATTGGGG + Intergenic
1197996306 X:132378603-132378625 TAAATCAAACGGAGAGATGGGGG - Exonic
1198032976 X:132772361-132772383 CAAATGAAAAAGAGGGATTGGGG - Intronic
1198205876 X:134464365-134464387 CAAATTATCCAAGGAGATGGCGG + Intronic
1198729442 X:139712840-139712862 CAAATTAAAGACAGCGATGTGGG - Intergenic
1199220102 X:145308100-145308122 CAAAAGGAAGAGAGAGATGGGGG + Intergenic
1199989932 X:152981513-152981535 CAAATAGAACAAAAAGATGGAGG + Intergenic
1200822821 Y:7605686-7605708 CAAATTAGACATGGAGAAGGGGG + Intergenic
1201056199 Y:9994637-9994659 CAAATTAGACATGGAGAAGGGGG - Intergenic
1201371259 Y:13267379-13267401 AAAAAAAAAGAGAGAGATGGAGG - Intronic
1201427321 Y:13866781-13866803 AAAATTAAACAGATACTTGGAGG + Intergenic
1202189882 Y:22230942-22230964 CAAATTAGACATGGAGAAGGGGG + Intergenic
1202237234 Y:22725403-22725425 CAAATTAGACATGGAGAAGGGGG - Intergenic