ID: 1071778094

View in Genome Browser
Species Human (GRCh38)
Location 10:88811577-88811599
Sequence TAGAGAATAGAGAAGGATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 640
Summary {0: 1, 1: 0, 2: 4, 3: 61, 4: 574}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071778094_1071778096 24 Left 1071778094 10:88811577-88811599 CCTTCATCCTTCTCTATTCTCTA 0: 1
1: 0
2: 4
3: 61
4: 574
Right 1071778096 10:88811624-88811646 TTGATATAATTTCCAATTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071778094 Original CRISPR TAGAGAATAGAGAAGGATGA AGG (reversed) Intronic
900876578 1:5347149-5347171 TAGATAATTGATAATGATGATGG + Intergenic
900912945 1:5615023-5615045 CAGGGAATATAGCAGGATGAAGG + Intergenic
902057687 1:13615880-13615902 GTGAAAATAGAGAAGGGTGACGG - Intronic
902564943 1:17305310-17305332 TAGGGAAGAGAGAAGGCCGAGGG - Intergenic
902650061 1:17831240-17831262 GAGGGAGTAGGGAAGGATGAAGG + Intergenic
902835732 1:19045555-19045577 TAGAGAATAGAGAGGCGTGCAGG + Intergenic
902977553 1:20099880-20099902 AAGACAAAAGAGAAGGATGAGGG - Intergenic
904491317 1:30861308-30861330 GAGAGAATAGAGAAGGATGCAGG - Intergenic
905035130 1:34913120-34913142 CAGAAAATGGAGAAGGAAGAAGG + Intronic
905488981 1:38328844-38328866 CAGAGAAGAGGGAAGGATGTGGG - Intergenic
905585646 1:39115468-39115490 TAGAGAATATAAGAGGAGGAAGG + Intronic
906005664 1:42467535-42467557 TATGAAATAGAGAAGGAGGAGGG + Intronic
906037995 1:42764927-42764949 TAGAGAGTAAAGAAGGCTGGGGG - Intronic
906371809 1:45260273-45260295 TATAGAATAGAGGAGCAAGATGG - Intronic
907063405 1:51454370-51454392 CAGAGAATAGAGTAGGAAAAGGG + Intronic
907767112 1:57423200-57423222 TGGAGCAGAGAGAAGGAAGAGGG + Intronic
907909252 1:58812875-58812897 CAGGGAAAAGAGGAGGATGATGG - Intergenic
908402277 1:63782781-63782803 TAGAGAATCTAGAAGAATGAAGG + Intronic
908531263 1:65036495-65036517 AAGAGACCAGAGAAGGGTGAGGG + Intergenic
908852042 1:68386489-68386511 TAGAGCAAAGAGCAGGAGGATGG - Intergenic
909397770 1:75189791-75189813 TAGAGATTACAGTATGATGAGGG - Intergenic
909698960 1:78499205-78499227 GAGAGAACAGAGAAGAAAGAGGG - Intronic
910668994 1:89754132-89754154 TAGAGGACAGAGAAGGAGAATGG - Intronic
910921828 1:92356734-92356756 TAGAGAATAAAAAAGGAAAATGG - Intronic
911068270 1:93811532-93811554 TACATAATAGAGAAGCATAAAGG - Intronic
911770635 1:101736632-101736654 TAGAGAATGAAGAAGAATGAGGG - Intergenic
911957511 1:104256346-104256368 GAGAGAAAAGGGAAGAATGAAGG - Intergenic
912111199 1:106345298-106345320 GAGAGAATAGAGAAGGAGAAAGG + Intergenic
912233864 1:107827291-107827313 TGGAGAATAAGGAAGGAAGAGGG - Intronic
912777658 1:112515932-112515954 TAGAGAGTAGTGAGGGCTGAGGG + Intronic
912902049 1:113661724-113661746 CAGAGAAAAGAGAAGGGTGGAGG + Intronic
913238455 1:116805996-116806018 TAGAGCCCAAAGAAGGATGAAGG + Intergenic
913453700 1:119009395-119009417 TAGAGAAAGGAGAAAGATGAAGG + Intergenic
913482087 1:119298518-119298540 CAGAGTATAGGCAAGGATGAGGG - Intergenic
913548018 1:119888744-119888766 TAAAGAATAAAGAATGATTAGGG + Intergenic
913691176 1:121281332-121281354 AAGAGAATGAAGAAGGAAGAAGG - Intronic
914681576 1:149942478-149942500 TAGAGAACAGGGAAGGGTCAGGG + Exonic
915541676 1:156571191-156571213 GAGAGAAGGGAGAAGGATTAAGG - Intronic
916270579 1:162937330-162937352 TGGAGAAGAAAGAATGATGAAGG - Intergenic
916808481 1:168283563-168283585 GAGAAAAGAGAGAAGGAAGAAGG - Intronic
916834010 1:168523405-168523427 TAGAAAATAGAGAAGTCTGCAGG + Intergenic
917813786 1:178687006-178687028 TGGAGAGTAGAGATGGAGGAAGG + Intergenic
918546210 1:185687452-185687474 GAGAGAAAAGAAAAGGAGGAAGG - Intergenic
919140173 1:193560476-193560498 TGGAGAAGAGAGAAAGAGGAGGG - Intergenic
919706682 1:200682963-200682985 TTGAGAATCCAGAAGGATGGGGG + Intergenic
919955164 1:202407198-202407220 TGGGGAATAGAGAAGATTGAGGG + Intronic
920049528 1:203154926-203154948 CAGAGAAAAAAGAAGGAAGAGGG - Intronic
920478500 1:206299808-206299830 AAGAGAATGAAGAAGGAAGAAGG - Intronic
920688427 1:208127650-208127672 TAGGGAGTAGAAGAGGATGAAGG + Intronic
921005312 1:211087171-211087193 TGTAGAATATTGAAGGATGAAGG - Intronic
921037530 1:211396085-211396107 TAGAAAATGGAAAAGGAGGACGG - Intergenic
922031507 1:221804645-221804667 GAGAGAACAGAGAAGGCAGAGGG - Intergenic
922064922 1:222127238-222127260 TGAAGAATAGAGCAGGATAATGG - Intergenic
922327806 1:224545305-224545327 GAGAGAAGAGACAAGGGTGAAGG - Intronic
922628247 1:227075692-227075714 TAGAGAATAAATTGGGATGAAGG + Intronic
923359705 1:233198896-233198918 TAATGAATCGAGAAGGATGAGGG + Intronic
923515073 1:234690282-234690304 GAGAGAAAAGAGAATAATGATGG + Intergenic
923727230 1:236517183-236517205 GAAAGAAAAGAGAAGGCTGAAGG + Intergenic
923993147 1:239461894-239461916 GAGAGAATTGAGAATGCTGAGGG - Intronic
924171954 1:241351672-241351694 AAGAGACTATATAAGGATGAAGG + Intronic
924185178 1:241481175-241481197 TAAAGAATATGGAAGGTTGAAGG - Intergenic
924187252 1:241506326-241506348 CAAAGTATAGGGAAGGATGAGGG + Intronic
1063280297 10:4621372-4621394 TAGAGTATAGAGTAGAATGGTGG + Intergenic
1063832982 10:9977886-9977908 TAGACACTGGAGAAGGAGGAAGG + Intergenic
1064196857 10:13250706-13250728 TAAAGCAGAAAGAAGGATGAAGG + Intergenic
1064318098 10:14276765-14276787 TAAAGAACAGAGCAGGAAGATGG - Intronic
1065881126 10:30038743-30038765 GAGAGAAGAGAGAAGCAGGATGG + Intronic
1066081404 10:31934241-31934263 TTTAGCATAGAGAAGGATAAAGG - Intergenic
1066111427 10:32200531-32200553 CAGAGAAGAGGGGAGGATGAGGG + Intergenic
1067026851 10:42849931-42849953 TAGAGAGGAGAGAAGGCTGGGGG + Intergenic
1067948531 10:50708144-50708166 TTTAGAATGGAGAAGGATGGAGG - Intergenic
1068027905 10:51671401-51671423 TAGAGATTACAGAGGGATCATGG - Intronic
1069352398 10:67544514-67544536 AACAGAATAGAGAATGATAAAGG + Intronic
1069854375 10:71431739-71431761 GAGAGAATAGAGCAGGGGGAAGG - Intronic
1070307849 10:75250505-75250527 GAAAGAGTAGAGAAGGAGGAGGG + Intergenic
1070883852 10:79873139-79873161 TTTAGAATGGAGAAGGATGGAGG - Intergenic
1071074251 10:81732462-81732484 TAAATAATAGACAAGGAGGACGG + Intergenic
1071366366 10:84904490-84904512 GAGAGAAAAGAGAAAAATGAAGG - Intergenic
1071650408 10:87389441-87389463 TTTAGAATGGAGAAGGATGGAGG - Intergenic
1071689819 10:87805242-87805264 TGGAGAATAGAAAAGAATTAAGG - Intronic
1071778094 10:88811577-88811599 TAGAGAATAGAGAAGGATGAAGG - Intronic
1072000904 10:91194750-91194772 TAGAGAAGAGAAGAGGATCAAGG + Intronic
1072050207 10:91696550-91696572 AAGGGAAGAGAGAGGGATGATGG + Intergenic
1073566548 10:104540222-104540244 TAGAAAAAAGAGCAAGATGAAGG + Intergenic
1073809010 10:107132150-107132172 GAGAGAAAAGAGAAAGAAGAGGG - Intronic
1074145924 10:110717270-110717292 TAAAGAATAGGAAAGAATGAGGG - Intronic
1075207397 10:120458738-120458760 TAGAAAATAGAGTAGGAGAAGGG - Intronic
1075372914 10:121952990-121953012 AAAAGCATAGTGAAGGATGAAGG - Intergenic
1076946708 10:133656573-133656595 CAGAGAGTAGAGAAGGAAGTCGG + Intergenic
1077838151 11:5943184-5943206 TAGAGAAAATAGAAGGAAAAAGG + Intergenic
1078281631 11:9908319-9908341 TTGTGAATAGAGAAGGCAGATGG + Intronic
1078316153 11:10294473-10294495 AACAGAATAGAGAAGGCGGAAGG - Intergenic
1079792081 11:24750695-24750717 TAGAGAGAAGAGAAAGTTGAGGG - Intronic
1079838242 11:25362937-25362959 AACAGAAGAGAGCAGGATGAGGG + Intergenic
1079867385 11:25753577-25753599 CAGAGAGTATAGAATGATGAAGG - Intergenic
1080110185 11:28557830-28557852 AAAAGAAGAGAAAAGGATGATGG - Intergenic
1080159778 11:29159912-29159934 AAGAGAAAAGAGGAGGAGGATGG + Intergenic
1080275849 11:30502729-30502751 AAGATAATAGAGAACAATGAGGG + Intronic
1082168748 11:48975926-48975948 TGGAGATTTGAGAAGCATGAAGG - Intergenic
1082986537 11:59174269-59174291 CAGAGAATAGAGAGGAATGTGGG + Intronic
1085874329 11:80387825-80387847 TAAAGCATATAGAAGGATGCAGG - Intergenic
1086354469 11:85980234-85980256 CAGAGGATAGAGAAGGAGGATGG + Intronic
1087719433 11:101645342-101645364 TAGATAATAAAGAATGATAAAGG + Intronic
1088535128 11:110852235-110852257 GAGAGAGCACAGAAGGATGAAGG + Intergenic
1088620558 11:111678065-111678087 TAAAGAACAGGGAAGGAGGAAGG - Intronic
1088883877 11:113992356-113992378 TGGTGAATAGAGAAGGCTGCAGG - Intergenic
1089512995 11:119012366-119012388 TAGGGAACAGTGAAGGAAGAAGG - Intronic
1089644671 11:119870898-119870920 AGGAGAATAAAGAAGGATAAGGG + Intergenic
1090583091 11:128181153-128181175 TAGAAAATAGAAAAGGATGGGGG + Intergenic
1090717572 11:129443624-129443646 TAGGCACTAGAGCAGGATGATGG - Intronic
1091024573 11:132130724-132130746 CAGAGAATAGGGAAGTCTGATGG + Intronic
1091365480 11:135016269-135016291 TGGAGGATGGAGAAGGCTGAGGG - Intergenic
1091478245 12:798980-799002 AAGAGAATAGGGAAAAATGAAGG - Intronic
1092387912 12:8050410-8050432 CAGGGAAGAGAGAAGGAGGATGG + Intronic
1092768919 12:11878805-11878827 TCTAGAATAGAGGAGGAGGAGGG + Intronic
1092857137 12:12684782-12684804 AAGAAAATAGAGAAGGAAGGAGG - Intronic
1092891424 12:12972735-12972757 CAGAGAATAAAAAAGGAAGAAGG - Intergenic
1093660716 12:21753474-21753496 TAGAGAATAAGGTAGGAGGATGG + Intronic
1093667133 12:21827994-21828016 AACAGAAAAGAGAAGGAAGATGG - Intronic
1093841254 12:23904234-23904256 TAGAGAAAAGAGAAGAAAAATGG - Intronic
1093957066 12:25232541-25232563 TGGAGCAAAGACAAGGATGAAGG + Intronic
1094269026 12:28590783-28590805 TAGAGAAAATACAAGGGTGAGGG - Intergenic
1094648937 12:32356349-32356371 GAGAGAATAGAGAATAAAGAGGG + Intronic
1096847719 12:54417347-54417369 TAGAAAAGAGGGAAGGAGGAAGG - Intronic
1096967830 12:55642743-55642765 TAGAGAAAGTAGAAAGATGAGGG + Intergenic
1097952812 12:65451391-65451413 TGAAGAATAGAGCAGGATGAGGG - Intronic
1098281313 12:68865491-68865513 AAGAAGATGGAGAAGGATGAGGG - Intronic
1098504854 12:71237612-71237634 TAGAAAAAAGAGGAGGAGGAGGG - Intronic
1098812375 12:75111243-75111265 TACAGACTAGAAGAGGATGAAGG - Intronic
1099185206 12:79508780-79508802 AAGCGAATAGAGCAGGAAGATGG + Intergenic
1099561353 12:84179261-84179283 TAGAAAATAGTGAGGGATGATGG - Intergenic
1099675833 12:85759490-85759512 AAGAGAAAAGAAAAGGAAGAGGG + Intergenic
1099855342 12:88157541-88157563 TAGAGAAAAAAAGAGGATGAAGG - Intronic
1099983575 12:89636194-89636216 TAGAGATCAGAAAAGGATGTGGG + Intronic
1100680910 12:96919540-96919562 TAGAGAAAAGAGAAAAATCATGG - Intronic
1101101722 12:101400442-101400464 TAAAGAATAAAGAAGGGTAAAGG + Intronic
1101141644 12:101801646-101801668 AGGAGAATAGAGAAGAAAGAAGG - Intronic
1101693578 12:107103484-107103506 AAGGGAATAGAGAAGGATGAGGG - Intergenic
1101887230 12:108676012-108676034 TAGGGAAAAGAAAATGATGAAGG + Intronic
1102196818 12:111032383-111032405 TAAAGAAGAGAGAATCATGATGG - Intergenic
1102899321 12:116624097-116624119 AAGAGAATGAAGAAGGAAGAAGG + Intergenic
1102988610 12:117298636-117298658 TAGAGAAAAGAGAAATTTGAAGG + Intronic
1103162840 12:118744492-118744514 GAGAGAAAAGAGAAAGAGGAAGG + Intergenic
1103260609 12:119585223-119585245 TCGAGAATGGAGAAGAATGGAGG - Intergenic
1104517771 12:129443582-129443604 GAAAGAATAGAGAAAGAGGAAGG - Intronic
1106214371 13:27681667-27681689 TAGAGAGAGGAGAATGATGAGGG + Intergenic
1106228274 13:27801469-27801491 CAGAGCATGGAGAAGTATGATGG + Intergenic
1106238782 13:27890066-27890088 TTGAGAATAGATAGTGATGATGG - Intergenic
1106712927 13:32357971-32357993 AAGAGAAGAAAGAGGGATGAGGG - Intronic
1107095220 13:36528305-36528327 CAGCGAATAGAGACTGATGAGGG - Intergenic
1107132040 13:36907197-36907219 TAGAGAAGAAAGTAGAATGAAGG + Intronic
1107345160 13:39452423-39452445 TAGAGAAGAGAAAGGGAGGAGGG + Intronic
1108118109 13:47152450-47152472 TAGAGAATAGAGAAAATTGAAGG - Intergenic
1108329821 13:49374115-49374137 TACAGGCTAGAGAAGGATAACGG + Intronic
1108430001 13:50343875-50343897 TAGAGAATTGAAGAGGATGGTGG + Intronic
1108577120 13:51800104-51800126 TAGGGAATAAAGGAGGAGGATGG + Intronic
1109175199 13:59146468-59146490 CAGAGAAAAGAGCAAGATGATGG + Intergenic
1109911048 13:68910900-68910922 AAAAAAAAAGAGAAGGATGAGGG - Intergenic
1110025387 13:70531541-70531563 TAGAGAAGGGAAAAGGAAGATGG - Intergenic
1110215509 13:73020609-73020631 CAGGTAATAGAGGAGGATGAAGG - Intergenic
1110426326 13:75371284-75371306 TAGAGAATACATAATGGTGAAGG + Intronic
1110638841 13:77798256-77798278 TAGAGAATAGAGAAGCTACATGG - Intergenic
1111475030 13:88734775-88734797 TAGAGAATAGAAAAGGTACAGGG + Intergenic
1113954916 13:114094494-114094516 TTGAAACTAGAGAGGGATGATGG + Intronic
1114318492 14:21527080-21527102 AGGAGAATAGAGGAGGAAGAGGG - Intronic
1115160451 14:30387928-30387950 TAGAGACAAGTCAAGGATGATGG - Intergenic
1115494814 14:33992673-33992695 TAGATAAGAGACAATGATGAGGG + Intronic
1116119068 14:40698144-40698166 TAGAGAGTGGGGAAGAATGAGGG + Intergenic
1116237675 14:42300185-42300207 TAGAGAATAAAGAAGGAGAGAGG + Intergenic
1116319002 14:43435653-43435675 TAGGGAAAAGGGAAGGGTGAGGG + Intergenic
1116389945 14:44380089-44380111 GAGAGAATTGAGAAGGAGAAAGG + Intergenic
1116500958 14:45621041-45621063 TTGAGAATAGAGAAGAAAAATGG + Intergenic
1116967041 14:51025774-51025796 TAGAGTAAAGAACAGGATGAAGG + Intronic
1117256440 14:53982891-53982913 CAGTGAATGGAGAAAGATGAAGG + Intergenic
1118263790 14:64273823-64273845 TGAAAAATAGAGAAGGAGGAGGG - Intronic
1118472194 14:66084660-66084682 TAAGGATTAGAGAGGGATGAGGG + Intergenic
1118490234 14:66251775-66251797 TAGACAATGGAAAACGATGAAGG - Intergenic
1118810268 14:69268031-69268053 AAGAGAAAGGGGAAGGATGAGGG - Intronic
1118998016 14:70854891-70854913 ATGAGGATTGAGAAGGATGATGG + Intergenic
1119476773 14:74934977-74934999 CAGAGAAGAGAGAAGGAGAAGGG + Intergenic
1120843677 14:89108238-89108260 AAGAGGATAGAGAAGCAGGAAGG - Intergenic
1121396386 14:93627274-93627296 TAGAGAAGAGACTAGGATCAAGG - Intronic
1121929260 14:97957476-97957498 TAAAGACTAGAAAAGGAAGAGGG - Intronic
1121950043 14:98163687-98163709 TAGAGAAGAAAGTAGGAGGATGG - Intergenic
1122916674 14:104862389-104862411 TAGAGAGTAGTGATGGATGGTGG - Intergenic
1123951349 15:25279934-25279956 CATAGAATAGAAAAGCATGAAGG - Intergenic
1124153103 15:27199932-27199954 CAGGAAAGAGAGAAGGATGAAGG - Intronic
1124659431 15:31533896-31533918 TAGAGAATAAAGAAGCAAAAAGG + Intronic
1125054793 15:35345403-35345425 TAGAGACAAGATAAAGATGATGG - Intronic
1125092776 15:35813679-35813701 TAGTGAATAGAGCAGGATAGAGG + Intergenic
1125327382 15:38549671-38549693 TAGAGACTAGAGGGGGAAGAGGG - Intronic
1126254076 15:46604295-46604317 TAGACAATAGATAAGGCAGATGG + Intergenic
1126380631 15:48043165-48043187 TAGTGAATATAGAAGGAGCAGGG - Intergenic
1126684208 15:51233187-51233209 AAAAGAATAGGGAAGGAGGATGG - Intronic
1126811776 15:52413833-52413855 TAAATAATAGAGAAGGAAGCAGG + Intronic
1126821607 15:52509868-52509890 AAGAGATTAGAGAAGGAGAATGG - Intronic
1126880498 15:53090300-53090322 TAGAAAATGAAGAAGGAAGAAGG - Intergenic
1127828902 15:62732388-62732410 TAAAGATGAGAGAAGGATGATGG + Intronic
1128430516 15:67588720-67588742 CAAAGAAGAGAAAAGGATGAGGG - Intronic
1128609128 15:69059846-69059868 AAGAGAAGAGAGAAGGAGCAAGG + Intronic
1128768573 15:70265723-70265745 TGGAGAATGGAGAAGGAAGATGG + Intergenic
1128839179 15:70835796-70835818 TATTGTATAGATAAGGATGATGG + Intronic
1128894225 15:71357724-71357746 CAGAGATTAGGGAAGGATAAAGG + Intronic
1128930161 15:71697145-71697167 TATAGAATGGGGAAGCATGAGGG + Intronic
1129501919 15:76047621-76047643 TAGAGGAGAGGGAAGGATAAAGG + Intronic
1129576487 15:76753448-76753470 TAGATAATAGAGTTGAATGAAGG + Intronic
1129601575 15:77001863-77001885 GAGAGAAAGGAGATGGATGAGGG + Intronic
1130303932 15:82700258-82700280 TAGAGATAAGAGAAGGTTGATGG - Intronic
1130782812 15:87061594-87061616 TACAGAATAGAGTAGGTTTAAGG + Intergenic
1131044540 15:89303033-89303055 AAGGGAATAAAGAAGGTTGAAGG - Intronic
1131199710 15:90386662-90386684 TAGAGAATATAGCAGGAGCAGGG + Intergenic
1131646451 15:94350134-94350156 TAGAGTATAAAGAAAGATGCTGG + Intronic
1131846582 15:96495345-96495367 TAGGGCACAGAGAAGGAGGAGGG + Intergenic
1132007280 15:98239757-98239779 CAGAGAACAGAGAATGTTGAGGG + Intergenic
1133191316 16:4135662-4135684 TAGAGGATAGGGATGGATGGAGG + Intergenic
1133456591 16:5947657-5947679 TTTACAATAGAGAAGGAAGATGG - Intergenic
1133534781 16:6691353-6691375 CAGAGAAGAGTGAAGAATGATGG - Intronic
1133981684 16:10637385-10637407 CAGTGAATAAAGAAGGAAGAAGG + Intronic
1134294114 16:12930006-12930028 GACCTAATAGAGAAGGATGATGG - Intronic
1135224925 16:20647468-20647490 TAGGGGTTACAGAAGGATGAAGG - Intronic
1136074799 16:27809657-27809679 GAGAGAAAAGAGAGGGATGGAGG - Intronic
1138139105 16:54551616-54551638 TATAGAAGGGAGAAGGATCAGGG - Intergenic
1138420161 16:56893665-56893687 GAGACAACAGAGAGGGATGAGGG + Intronic
1139285682 16:65811590-65811612 TTGAGAATAAAGGAGAATGATGG + Intergenic
1140193400 16:72837168-72837190 GAGAAAATGGAAAAGGATGAAGG - Intronic
1140752414 16:78037503-78037525 GAGAGAATGGAGAGGGATGAAGG - Intronic
1140982030 16:80119663-80119685 TATGGAATAGAGAAGGAAGAAGG - Intergenic
1141185700 16:81785558-81785580 GACAGGATAGAGAAGGATGTTGG + Intronic
1144075333 17:11714545-11714567 AAGAGACTATAGAAGGGTGAGGG - Intronic
1144117117 17:12107243-12107265 TACAGAACAGAGCAGGATAAGGG + Intronic
1144317603 17:14077891-14077913 TTGAGAGCAGAGAAGGATCAGGG + Intronic
1144361912 17:14503657-14503679 AAGAGAATAGAGGAAGATAACGG - Intergenic
1145299643 17:21623900-21623922 TAGAGAGTAAAGAAGGACGAAGG + Intergenic
1145350640 17:22079367-22079389 CAGAGAGTAAAGAAGGACGAAGG - Intergenic
1146435317 17:32840621-32840643 AAAAGAGTAGAGAAGAATGAGGG - Intronic
1146635384 17:34500340-34500362 GAGAAAACAGAGCAGGATGAGGG - Intergenic
1146949454 17:36895646-36895668 TAGAGAATAGTCAGGGATGAAGG - Intergenic
1147680259 17:42238872-42238894 TGGAGAATTGTGAAGGGTGAGGG + Intronic
1148511004 17:48169777-48169799 TAGATAATGGAGAAGGAGCAGGG + Intronic
1148812941 17:50306139-50306161 TAGGGGATAGAGAAATATGAGGG - Intergenic
1149381461 17:56098183-56098205 TAGAGCCTAGAGAAGGAGGATGG + Intergenic
1150502032 17:65660286-65660308 GAGAGAAAAGAGAAGGAGGGAGG - Intronic
1150689734 17:67354618-67354640 TAGAAAATAGAGTAAGACGATGG + Intronic
1150870115 17:68898372-68898394 TAAAGAATAAAAAATGATGAAGG + Intronic
1151345810 17:73500549-73500571 GGGAGGATGGAGAAGGATGAAGG - Intronic
1151915151 17:77112396-77112418 TAGATAAGAGAAAAGGATTAAGG - Intronic
1153394148 18:4598814-4598836 TAGAGAACAGAAATGGAGGATGG + Intergenic
1154976293 18:21460728-21460750 TTGCTAAGAGAGAAGGATGAGGG - Intronic
1155925553 18:31651744-31651766 AAGAGAACTGGGAAGGATGAGGG - Intronic
1156117008 18:33797735-33797757 TAGATATTAGAGAATGATCATGG - Intergenic
1156669973 18:39456563-39456585 TTGAGAATAGAAGAGGATTAAGG - Intergenic
1158253577 18:55518795-55518817 AAGAGAATAAAGAAGTGTGACGG + Intronic
1158624036 18:59056572-59056594 GAGAGGATCGAGAAGGAGGATGG - Intergenic
1158734257 18:60061936-60061958 TAGAATATAGAGAAGGATCCTGG + Intergenic
1158798871 18:60881861-60881883 TAGAGAATAGAAAATGAGGCTGG + Intergenic
1159097906 18:63925705-63925727 TAATGAATACAGAAGAATGATGG + Intronic
1159183131 18:64935881-64935903 TAGAGTATAGAGAGGAAGGATGG - Intergenic
1159546505 18:69845573-69845595 GAGAGAATAGAGAGGCAGGATGG + Exonic
1159802034 18:72913028-72913050 TTGAGAATAATGAGGGATGAAGG + Intergenic
1160001878 18:75032496-75032518 GAGAGAAGAGAGAAGGTTGGTGG - Intronic
1160676607 19:394531-394553 GAGAGGATGGAGAAGGAAGATGG + Intergenic
1162121144 19:8469720-8469742 TGGAGAAGAAAGATGGATGAGGG + Intronic
1162678226 19:12317108-12317130 TAGAGTATACAGGAGGATGTGGG + Intergenic
1165591275 19:36972405-36972427 AAGGGACTGGAGAAGGATGAGGG - Intronic
1165844277 19:38808296-38808318 GAGAGAACAGAGAAAGAGGAAGG + Intronic
1166157454 19:40924569-40924591 CAGAGCATAGTGAAGCATGATGG + Intergenic
1166959364 19:46488496-46488518 TAGAGAGGAGGGCAGGATGAAGG - Intronic
1168677318 19:58288187-58288209 AAGAGAATAAAGAAGGGTGTGGG - Intronic
925055428 2:853525-853547 GAGAGAGAAGAGAAGGGTGAAGG - Intergenic
926301225 2:11604472-11604494 GAGAGAAGAGAGGATGATGATGG - Intronic
926347292 2:11959450-11959472 TAGAGAATGGGCAAGGATTAGGG - Intergenic
926591896 2:14749397-14749419 TGGAGAATGGTGCAGGATGAAGG - Intergenic
926592108 2:14750968-14750990 GAGAGGAAAGAAAAGGATGAGGG + Intergenic
926914870 2:17881353-17881375 TAGAGAAGAGAATAGGATGTGGG + Intronic
927236835 2:20882437-20882459 AAGAGAAAAGGGAAGGATAAGGG - Intergenic
927405797 2:22765167-22765189 AAGAGAATAGAGAATAATAAAGG + Intergenic
928017555 2:27672351-27672373 TAGAGAAGACAGAAAGATAAAGG - Intronic
928133445 2:28670186-28670208 GAGAGAAGAGAGATGGATGGTGG + Intergenic
928395002 2:30936876-30936898 TAGAGAATATGGAAAGATAAAGG - Intronic
928662527 2:33517692-33517714 TAGAAAATAGGTAAGGATGGAGG + Intronic
928884426 2:36131987-36132009 TAAAGAATAGAGAAGACTGTTGG + Intergenic
929241694 2:39660075-39660097 TAGAGAGTAGTGAATGAGGAAGG - Intergenic
929430454 2:41881992-41882014 AAGGAAAGAGAGAAGGATGATGG - Intergenic
929820198 2:45267160-45267182 TGGGGAAGAGAGAAGGATTAGGG - Intergenic
929965350 2:46530393-46530415 TGGAGAAGGGAGGAGGATGATGG - Intronic
931015503 2:57975471-57975493 TAAAAAATAGAGATGGAGGAAGG - Intronic
931705392 2:64942659-64942681 AAGAGAATAAAGCAGCATGAGGG + Intergenic
932394301 2:71429879-71429901 AAAAGAATAGACAAGGAAGAAGG - Intronic
933256392 2:80085826-80085848 GAGAAAAGAGAGAAGGGTGAGGG + Intronic
933358441 2:81245275-81245297 TACAGATGAGAGGAGGATGATGG + Intergenic
933783762 2:85821709-85821731 TAAAGAATACATAACGATGAAGG + Intergenic
935856171 2:107276828-107276850 CAAAGAATGGAGAAGGTTGATGG + Intergenic
936492443 2:112983841-112983863 TAGAGAATAGAGTAGGTTCAAGG + Intronic
936827414 2:116599285-116599307 TGGAAAATAGAAAAGAATGAAGG - Intergenic
936870350 2:117129181-117129203 GAGAGAAGAGAGAAGGAAGAAGG - Intergenic
936941166 2:117885896-117885918 TAGAGAATAACGGAGGAGGATGG + Intergenic
937112904 2:119380396-119380418 AAGAGAAAATAGAAGGAGGAAGG + Intergenic
937174249 2:119911132-119911154 TAGACAATAAAGAAGGAACATGG + Intronic
937708556 2:124950477-124950499 TGCAGAATGGAGAAGGATCAGGG - Intergenic
937883827 2:126886832-126886854 TCGGGAAGAGAGAAGGAAGAGGG - Intergenic
938003207 2:127763420-127763442 TAGAAAATAGAGAAGGAACATGG - Intronic
938654645 2:133418528-133418550 GTGAGAAAAGAGAAGGATCAGGG + Intronic
938739338 2:134216399-134216421 TAGAGAATGAAGAAGAATGAAGG + Intronic
938828523 2:135031210-135031232 AAGTGAATACAGGAGGATGATGG + Intronic
939844652 2:147228736-147228758 GACAGGATAGAGAAGGATGAAGG - Intergenic
940595383 2:155785095-155785117 GAGAGAATAGAGGACAATGAAGG + Intergenic
941203986 2:162548540-162548562 GAGACCACAGAGAAGGATGAAGG + Intronic
942022499 2:171880740-171880762 TAGAGAAAATAGAATAATGATGG - Intronic
942193619 2:173495483-173495505 TAGAGTGTAGCGAAGAATGAAGG + Intergenic
942238547 2:173936871-173936893 TAGAGAAGAGAGAAGTTTAATGG - Intronic
942387179 2:175454892-175454914 TAGAGGGTAGAGTAGGAAGAGGG - Intergenic
942512703 2:176719063-176719085 TAGAGAATACTGGGGGATGAGGG + Intergenic
943363405 2:186947150-186947172 TAGAAGCTAGAGAATGATGAAGG - Intergenic
943726814 2:191260071-191260093 TAGAGAATGGAGAAGCACTAAGG + Intronic
943821113 2:192322172-192322194 AAGAGAAAATAGAAGCATGAAGG - Intergenic
943976915 2:194493655-194493677 CAGAGAAAAGAGAAGGAAGCTGG + Intergenic
944359110 2:198830756-198830778 GAGAGAATAGAAAAAAATGATGG - Intergenic
944450219 2:199834794-199834816 AAGAGAGTAGAGAAAGAAGAAGG - Intronic
946389462 2:219406747-219406769 GTGAGAAGACAGAAGGATGATGG + Intergenic
946668768 2:222079598-222079620 TAGAGGAGGGAGAAGGAAGAAGG - Intergenic
946915081 2:224510815-224510837 TACAGAATGGAAAAGGAGGAAGG - Intronic
947282497 2:228470931-228470953 GAGAGAATAGAGAAAGATGGGGG - Intergenic
947351675 2:229252870-229252892 TAGAGAAAAGACAAGGAGGTGGG + Intronic
947605327 2:231482301-231482323 TGGAGAACAGAGAAGGGTCATGG + Intronic
948101527 2:235377981-235378003 GAGAGAAGAGAGAAGGACGAGGG - Intergenic
1169373868 20:5050385-5050407 TAGAGAAGGGGGAAGGATAACGG - Intergenic
1170287166 20:14722347-14722369 TAAAGAATTGAGAACAATGATGG + Intronic
1170348421 20:15413498-15413520 GAGATAGTAGAGGAGGATGAAGG + Intronic
1170776126 20:19376126-19376148 AAGAAAATAAATAAGGATGAAGG + Intronic
1171272891 20:23830049-23830071 TTGAGACTAGAGAATGACGACGG + Intergenic
1171782703 20:29435510-29435532 TAGAGATGGCAGAAGGATGAGGG + Intergenic
1172250855 20:33478121-33478143 TATGGAAAAGAGCAGGATGAAGG - Intergenic
1173069535 20:39749182-39749204 AAGAGAAAATAGAAAGATGAAGG - Intergenic
1173109404 20:40172112-40172134 TAGAGAATAGACAAGGAAAGAGG - Intergenic
1175128840 20:56774127-56774149 TAGAGATCAGAGAAGGAAGAAGG - Intergenic
1176107363 20:63395728-63395750 AAGAGAGTAGAGAGGGAAGAAGG + Intergenic
1176263589 20:64196770-64196792 CAGAGAATAGAGAGGGTTGCAGG - Intronic
1177407586 21:20690479-20690501 GGGAGAAGGGAGAAGGATGAGGG + Intergenic
1178165700 21:29973609-29973631 TAGACTATTGAGAAGGAGGAAGG - Intergenic
1178335631 21:31740178-31740200 TAGAAAATAGAGAAGGAGGTCGG - Intergenic
1178829917 21:36047395-36047417 TATAGAAGAGAGGAGGCTGATGG - Intronic
1179793383 21:43768413-43768435 GGGAGAATAGGGAAGGAAGAAGG + Intergenic
1181999052 22:26905182-26905204 TAGAGAAGAGAGGAGAAAGACGG + Intergenic
1182069819 22:27455662-27455684 TGGTGACTAGAGAAGAATGAGGG - Intergenic
1182391840 22:30004226-30004248 TAGAGAGTAGTGAAAGCTGAAGG + Intronic
1182786882 22:32915450-32915472 TAAAAAATAAAGCAGGATGACGG + Intronic
1183602640 22:38849021-38849043 TAGAGGAGAGGGAAGGATGGAGG - Intergenic
1184888819 22:47367237-47367259 AAGAGTACAGGGAAGGATGAAGG - Intergenic
949128839 3:477244-477266 AAGTGTATAGAGAAGGATAATGG - Intergenic
949132108 3:515969-515991 GGGAGAGTAGAGAAGGAAGAAGG + Intergenic
949396615 3:3621311-3621333 CAGAGGATAGAGAAGGCTGGAGG - Intergenic
949411435 3:3769383-3769405 GAGAGAATAGAGATGGAAAAGGG - Intronic
950044839 3:9943051-9943073 GAGAGAGGAGAGAAAGATGAGGG - Intronic
950907540 3:16552904-16552926 TAGAGAATAGGGAAGAAAGGAGG + Intergenic
950950892 3:16997363-16997385 TAGAGAAGAGAGAACACTGAGGG + Intronic
951218264 3:20043888-20043910 GAGAGATTAGAGAATGAGGAGGG + Intronic
951221798 3:20076356-20076378 TAAAGAATAGAGAAGAAACAAGG - Intronic
951655359 3:25001445-25001467 AAGACAATTGAGAAGGATAAGGG - Intergenic
951741061 3:25923841-25923863 TAGAGGATGAAGAAGGACGAAGG + Intergenic
952181768 3:30924097-30924119 TAGATATTAGGGAGGGATGAGGG + Intergenic
952964819 3:38614675-38614697 AAGAGAAAAGGGCAGGATGAGGG + Intronic
953221094 3:40972278-40972300 TAGAGTAGGGAGAAGGATGCAGG - Intergenic
953225716 3:41017639-41017661 AGGAAAATAGTGAAGGATGATGG + Intergenic
953589629 3:44239093-44239115 TAAAGTATACAGAAGGATGTGGG - Intergenic
953744802 3:45566218-45566240 TACAGAATAGAGAAGGAGAGAGG - Intronic
954630390 3:52044836-52044858 AAGAGGAGAGAGCAGGATGAAGG - Intergenic
954856977 3:53652523-53652545 TAGGGAAAAGAGAAAGATCAGGG + Intronic
955197555 3:56819339-56819361 TAAAACATGGAGAAGGATGAGGG - Intronic
956734617 3:72228613-72228635 TAGAGAACAGGGAAGAAGGAAGG + Intergenic
957822547 3:85397705-85397727 TAGAGACTATTGAAGGCTGAGGG + Intronic
958116295 3:89222654-89222676 TAAAAAATTGAGAAGGGTGAAGG + Intronic
958592054 3:96170779-96170801 GAGAGAATAGAGGAGGAAAAAGG - Intergenic
958870335 3:99551194-99551216 CAAAGGATAGAGAATGATGAGGG + Intergenic
959013378 3:101105159-101105181 GAGAGAATAGAGGAAGAGGATGG - Intergenic
959253361 3:103976806-103976828 TTGAAAATAGAGTAGGATTAAGG + Intergenic
960104287 3:113777378-113777400 TATAAAATAGGGAAGGAGGAAGG + Intronic
960509117 3:118526810-118526832 TAGATAGGAGAGAAGGATGCTGG - Intergenic
960618839 3:119620206-119620228 CATAGCATAGGGAAGGATGACGG - Intronic
960785885 3:121372434-121372456 TAGAGAAGAGAGAAGCATTAAGG - Intronic
960820313 3:121723875-121723897 TAAGGAACAGAAAAGGATGAAGG + Intronic
960873397 3:122273704-122273726 TACAGCATGGAGAAGGATGATGG + Intronic
961203790 3:125064978-125065000 TAGAGAATAGAGAAGCCAGAAGG - Intergenic
961404699 3:126669704-126669726 TAAAGAATAGCCAAGTATGATGG - Intergenic
963204263 3:142616327-142616349 TAGAGAAAAAAGAATGATGGAGG + Intronic
963219390 3:142790591-142790613 TAGAGAAAAGAAAAGGATCAGGG + Intronic
963639146 3:147837011-147837033 TGGAGAACAGAGAAGAGTGAAGG - Intergenic
964271447 3:154960574-154960596 TATTGCATAGAGAAGGAGGAAGG + Intergenic
964473768 3:157080528-157080550 GAGAGAATTGAGATGAATGAGGG + Intergenic
964828315 3:160854421-160854443 TAGGGAACAGTGAAGGATAAGGG + Intronic
965570671 3:170168824-170168846 TAGAGAAAAGAAAAGAATGCAGG + Intronic
965679254 3:171233606-171233628 TGGAGAAAGGTGAAGGATGATGG + Intronic
966406035 3:179599347-179599369 TGGAGAGTAGAGAAGGCAGATGG + Intronic
968501397 4:951829-951851 TAGAGAAGAGAGAAGGTTCTGGG + Intronic
969199308 4:5589971-5589993 TAGAGAAAAGAGAAGGTGGAGGG + Intronic
969692899 4:8715435-8715457 CAGAAAATAGAGGAGGAGGAAGG - Intergenic
970346110 4:15153720-15153742 GAAAGAAGAGATAAGGATGAAGG - Intergenic
970589015 4:17542834-17542856 TAGAGATAACAGAAGAATGAAGG + Intergenic
970998918 4:22300793-22300815 TGGAGAATAAAGAGGGAAGAAGG - Intergenic
971477184 4:27083517-27083539 TAGAGACTTCAGAAGGAGGATGG - Intergenic
971762932 4:30791595-30791617 TAGAGAATATTGAAGGATCAGGG - Intronic
971961031 4:33487300-33487322 GAGGGAAAAGAGAAGAATGAGGG + Intergenic
972065005 4:34931123-34931145 TAGAGAAAAGAGTAGAATGGTGG + Intergenic
972618580 4:40723939-40723961 TAGAGAATAGGGAAGAGTGTAGG - Intergenic
972663629 4:41142714-41142736 CAGAGAAGAGAGAAGGACGTTGG - Intronic
972987281 4:44779993-44780015 AAGAGAATAGAGAAGGAGATGGG - Intergenic
973170389 4:47135604-47135626 TAGAGAATAGGGAGTGATGATGG - Intronic
973695477 4:53486379-53486401 TAGAAAAAAGAGAGGGATGCTGG - Intronic
973746383 4:53967218-53967240 TAGAAAATAGAAATTGATGATGG - Intronic
973792648 4:54392641-54392663 TAGAGAAGAGAGACTGCTGATGG + Intergenic
973864842 4:55102116-55102138 TAGATAATAGAACAAGATGAAGG - Intronic
973875571 4:55215214-55215236 TTGCTAATAGAGAAGGTTGAAGG - Intergenic
974166724 4:58213942-58213964 TTGAGAATACAGAAGGATTGGGG + Intergenic
975723284 4:77268732-77268754 TAGAGAAGTGAGATGGAGGAGGG + Intronic
975909795 4:79253421-79253443 TAGAGAAGAGAAGAGGCTGAGGG + Intronic
975967592 4:79993352-79993374 GAGAGAATAAAGAAGGAGGAAGG + Intronic
976110152 4:81664239-81664261 AAGAGAGTACAGAAGGCTGAAGG + Intronic
976352065 4:84070867-84070889 GAGAGAAAAGAAAAGGATGCTGG + Intergenic
976852331 4:89561693-89561715 GAGAGAATACAGTATGATGAGGG - Intergenic
977255020 4:94731139-94731161 TAGAGTATAAAGAAGGAGTATGG + Intergenic
978070339 4:104459760-104459782 TAAAGGAAAGAGAAGGAAGAGGG - Intergenic
978719092 4:111884964-111884986 AAGAGAAGAGAGAAGGAAGAAGG - Intergenic
978752011 4:112260288-112260310 CTGAGAAAAGGGAAGGATGAAGG + Intronic
979117950 4:116851352-116851374 TAAAGAATAGAGTAGAATCAGGG - Intergenic
979211855 4:118114240-118114262 TAGGGAAAACTGAAGGATGAAGG - Intronic
979483851 4:121248496-121248518 TAGAAAATATAGAAGAATGTGGG + Intergenic
979742136 4:124165338-124165360 TAGGGGAGAGAGAAGGAAGAGGG - Intergenic
980096027 4:128491788-128491810 TACAGAAAAGAGAAAAATGATGG - Intergenic
980289230 4:130824359-130824381 TAGAGAAAAGAGAGGGAGGGAGG - Intergenic
980637683 4:135529871-135529893 TGGGGGATAGAGAAGGATGCAGG + Intergenic
981206079 4:142042023-142042045 TAGAGAATACAAAAGCATCAAGG - Intronic
981235678 4:142412669-142412691 CAGAGAATACAGAAGAAAGATGG - Intronic
981705831 4:147658281-147658303 TAGAAAATAGAGGGGGATGGAGG + Intronic
982309212 4:153966657-153966679 TGGTGAATTGAGAATGATGAAGG + Intergenic
982709333 4:158744474-158744496 GGGAGAAGAGAGAAGGAGGAAGG + Intergenic
982910155 4:161130987-161131009 TACAGAATTGAGATGGCTGAAGG + Intergenic
983426395 4:167589094-167589116 TAGAGAATAGTGGAGGATGAGGG + Intergenic
983483232 4:168301426-168301448 TAGAAAGTACAGAAAGATGAGGG + Intronic
983620052 4:169751525-169751547 CCGTGAATAGAGAAGGAAGATGG - Intronic
984518155 4:180767695-180767717 TAGAGAGTTGAGGAGGGTGAGGG - Intergenic
985450164 4:190057372-190057394 CAGAGAGTAGAGAAGGAAGTCGG + Intergenic
986129375 5:4912731-4912753 GAGAGAAAGGAGAAGGAAGAAGG + Intergenic
986184646 5:5423915-5423937 TAGAAAATAAAGGAGGATGTTGG + Intronic
986211595 5:5678730-5678752 GAGAGAAAGGAAAAGGATGAGGG + Intergenic
986221761 5:5774872-5774894 GAAAGAAGAGAGAAGGAAGAAGG - Intergenic
986961116 5:13214144-13214166 TAGATAAAACAGAAGGATAAGGG - Intergenic
988185746 5:27859359-27859381 AAGAGAAAATAGAAGGAGGAAGG + Intergenic
988247500 5:28706466-28706488 TAAAGTTTGGAGAAGGATGATGG - Intergenic
988790118 5:34600101-34600123 AAAAGCATAGAGAAGGAAGAAGG + Intergenic
989142325 5:38213879-38213901 TAGAGAAAAGAGAATGAGGAGGG + Intergenic
990758965 5:59107529-59107551 GAGATAATAGAGATGTATGAAGG + Intronic
990799238 5:59581198-59581220 AAGAGGAGAGAAAAGGATGAGGG + Intronic
991510080 5:67366256-67366278 TATAAAAGAGAAAAGGATGATGG + Intergenic
991541333 5:67732580-67732602 TAGAGAACAGAGGAGGGTGGAGG + Intergenic
991938392 5:71826591-71826613 TAAAGAATAAAAAAGAATGAAGG - Intergenic
992629097 5:78663772-78663794 TAAAGTATACAGAAGGATGCTGG + Intronic
992852027 5:80820122-80820144 AAGTGAATAAATAAGGATGAGGG + Intronic
994967003 5:106685559-106685581 TAGAGAATAGAATAGAATGAAGG + Intergenic
995167386 5:109060170-109060192 TAGACAATAGACAGGCATGAGGG + Intronic
995184636 5:109259119-109259141 TAGAGGAGTGAGAAGGAAGAGGG + Intergenic
995308315 5:110680971-110680993 GAGGGAAAAGAGAAGGGTGAGGG + Intronic
995366102 5:111362913-111362935 TAGAGATTAGAAAATGATAATGG - Intronic
995942691 5:117602987-117603009 AAGAGAAGAGAGGAGGAAGAAGG + Intergenic
996368855 5:122732091-122732113 TAGATATTAGAGAATGAAGAGGG - Intergenic
996533078 5:124546560-124546582 AAGAAAAAAGACAAGGATGAGGG + Intergenic
996546804 5:124688027-124688049 TTCAGAATAAAGAAGGATGAAGG - Intronic
996926862 5:128837700-128837722 AAGGGATTAGAGAAGGAGGAAGG + Intronic
997163178 5:131631097-131631119 TAGAGAATAGAAGAGGACCAAGG - Intronic
997253249 5:132407620-132407642 AAGAGAAGAGGGAAGGATGGAGG + Intergenic
997444893 5:133933751-133933773 AAGTGGATAGAGAAGGAGGAGGG - Intergenic
997720722 5:136076720-136076742 TTCAGACTAGAGAAGGAAGAGGG - Intergenic
998597770 5:143551761-143551783 AAGAGAAGAGAGAGTGATGAGGG - Intergenic
998894505 5:146785188-146785210 AAGAGTATAGAAAAGGAGGAAGG + Intronic
999037948 5:148374735-148374757 TAGCAAATAGAGCAGGATGAAGG - Intergenic
999881179 5:155866213-155866235 TAGAGAAAAGAGATGGAGGGAGG - Intergenic
1000021519 5:157322911-157322933 TAGATAGGAGAGAAGGAAGAGGG - Intronic
1000409417 5:160922450-160922472 TAAAGAATGGAGGAGGATGTGGG + Intergenic
1000451524 5:161394808-161394830 CAGAAAATAGAGAAGGAAGATGG + Intronic
1000620609 5:163481663-163481685 TAAGGAAGAGAGAATGATGAAGG - Intronic
1000674923 5:164108861-164108883 TAGAGAATGAAGCAGAATGAAGG + Intergenic
1000712077 5:164592802-164592824 TTGATAAAATAGAAGGATGAAGG + Intergenic
1001224537 5:169932409-169932431 GAGAGAATGGGGAAGGAAGATGG + Intronic
1001266432 5:170277840-170277862 AAGAGGAAAGAGAAGGAGGAAGG + Intronic
1001455097 5:171854231-171854253 TAGGGAAGTGAGAAGGAAGAGGG - Intergenic
1003529088 6:6922767-6922789 TGGAGAGTAGAGAAGCAAGATGG - Intergenic
1004208076 6:13611028-13611050 TAGAAAAAAGAGAAAGAGGAAGG - Intronic
1005590455 6:27320037-27320059 TAAAGTATAGAGAAAAATGATGG - Intergenic
1005603270 6:27448872-27448894 TAGATAATAAAGCAGGGTGAAGG - Intergenic
1005883114 6:30075082-30075104 GAGAGAAAAGCAAAGGATGAGGG - Intronic
1006223957 6:32520439-32520461 TAAAGCAGAGAGAAGGATTAAGG + Intronic
1006728494 6:36217398-36217420 GAGAGACTAGAGATGGATAAGGG - Intronic
1006823378 6:36916085-36916107 GGGAGAAGAGAGAAGGAGGAAGG - Intronic
1007066595 6:38997016-38997038 GAGAGAACAGAGGAGGACGAAGG - Intronic
1007828181 6:44617478-44617500 GAGAGCTTAGAGATGGATGAAGG - Intergenic
1008752115 6:54747504-54747526 AAGAGAAAAAAAAAGGATGAAGG - Intergenic
1009195930 6:60684371-60684393 AAGAGAAGAGAGAAGGAGGGAGG + Intergenic
1009779373 6:68250005-68250027 TAGCAAATATAGAAGGGTGAGGG - Intergenic
1010067986 6:71708502-71708524 TAAAGAATAGAAAAGGAACAGGG - Intergenic
1010674197 6:78721718-78721740 TGCAGAAGAGAGAAGAATGAGGG - Intergenic
1010789051 6:80043286-80043308 TAGGGTAGAGGGAAGGATGAAGG - Intergenic
1011312580 6:85996611-85996633 TAGAGATTAGAGGAAGATCAGGG - Intergenic
1011426275 6:87234880-87234902 TTGAGAATAGACAAGTAGGAAGG + Intronic
1011819601 6:91235755-91235777 AAGAGCCTAGAGAAGGATGGAGG - Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012325611 6:97912477-97912499 TAGGGAAGAGAGAAATATGAGGG + Intergenic
1012676563 6:102120548-102120570 TAGAGCATAGATAATGGTGATGG + Intergenic
1012762768 6:103322784-103322806 TAAAGATTGGAGAAGGAGGAGGG - Intergenic
1013002174 6:106034225-106034247 TAGAGAATAGAAAACAATAAAGG - Intergenic
1013446072 6:110228423-110228445 TACAGAATAAAGAAAGATTAAGG - Intronic
1014668136 6:124265675-124265697 TAGAGAATGGAGTAGCATCATGG - Intronic
1014810821 6:125883677-125883699 TAGGGGAAAGAGAAGGATGGGGG - Intronic
1015039683 6:128702265-128702287 TAGAGAATAAATAACAATGATGG + Intergenic
1015741976 6:136466455-136466477 TGGAAAATAGAGAATGATGATGG + Intronic
1015857494 6:137640751-137640773 TAGAGATTTGACAAGTATGAGGG - Intergenic
1016134912 6:140528654-140528676 TAAAGATTAGTGAATGATGAAGG - Intergenic
1016578911 6:145605462-145605484 CAGACAAGAGAGAAGGATAATGG - Intronic
1016681438 6:146833650-146833672 GAGATAATAGAGAAGGCAGAAGG + Intergenic
1021536412 7:21709619-21709641 GAGAGGATAGAGAATGATGAAGG - Intronic
1021681983 7:23142240-23142262 TAAAATATAGAGAAGGATGTGGG - Intronic
1021918810 7:25462898-25462920 TAGAGGATAGAGAAATATGCTGG - Intergenic
1022270976 7:28807810-28807832 TTGAGAATGAAGAAGGAGGAAGG + Intronic
1023768139 7:43531055-43531077 TAGAGCATACAGAATGAGGAAGG - Intronic
1024007552 7:45238221-45238243 GAGACAACAGAGAAGGCTGAAGG - Intergenic
1024770284 7:52714105-52714127 TAGATAAAGGAGGAGGATGAAGG - Intergenic
1025035270 7:55589713-55589735 CACAGAAAAGAGAAGGGTGAGGG - Intergenic
1025744888 7:64233945-64233967 AAGAGAGTCAAGAAGGATGAAGG + Intronic
1026206234 7:68260278-68260300 GAGACAAAAGAGAAGGAGGAAGG - Intergenic
1026308123 7:69160193-69160215 TAGAGAAAATAGAAGAATCAAGG - Intergenic
1026484777 7:70808452-70808474 TAGACACTGGAGAAGGAAGAAGG + Intergenic
1026556366 7:71412107-71412129 TAGAGAATGTAGAAGGAAGAAGG - Intronic
1026581793 7:71624506-71624528 AAGAGAATGGAGAAAAATGATGG + Intronic
1027702898 7:81490985-81491007 GAGCTAATAGATAAGGATGAGGG - Intergenic
1027723545 7:81773612-81773634 TAGGAAATAGAGAAGCCTGAGGG - Intergenic
1029794600 7:102880984-102881006 GAGAGAGTAGAAAAGAATGAGGG + Intronic
1030462198 7:109853615-109853637 TAGAGAATAAATGAGGATGTGGG - Intergenic
1030565294 7:111146602-111146624 TAGATGATAGAGCAGGATGTAGG - Intronic
1030759107 7:113328868-113328890 TAGATAATAGAGAAAGAAAATGG - Intergenic
1031099437 7:117461167-117461189 TAGATAATAGAATATGATGAGGG - Intergenic
1031935243 7:127729370-127729392 TAAATAAAAGAGAAAGATGAAGG - Intronic
1032876071 7:136039613-136039635 TATAAAATGGAGAAGGAGGAAGG - Intergenic
1032910311 7:136420944-136420966 TAGAATATAGAGAAGGTTGTTGG - Intergenic
1032989013 7:137370201-137370223 TAGAGGAGAGAGAAAGATAAAGG + Intergenic
1033124745 7:138697810-138697832 AAGAGAGAAGAGAAGGAAGAAGG + Intronic
1033238319 7:139656084-139656106 AAGAGGAGAGAGAAGAATGATGG - Intronic
1033603359 7:142906702-142906724 AAGAGAATAAAGAAGAATGATGG + Intergenic
1033834483 7:145292540-145292562 TAGATAATAGAGAATGAGAAGGG - Intergenic
1034261787 7:149761438-149761460 TGGAGATTAGAGAAGGAGGAGGG + Intergenic
1034732552 7:153400553-153400575 TAGAGGGGAGAGAAGGAGGAAGG + Intergenic
1035695783 8:1594831-1594853 TAGAGCACAGAGAAAGATCAGGG - Intronic
1036564941 8:9930600-9930622 TAGAAATTAGAGACAGATGATGG - Intergenic
1036611743 8:10356164-10356186 TAGAGAAAAGACAAGAAAGAAGG - Intronic
1036734709 8:11301863-11301885 TATGGAACAGAGAAGGAAGATGG + Intronic
1037675737 8:21049509-21049531 TAGAAACTAGAGATGGAGGAAGG + Intergenic
1037847505 8:22296775-22296797 TATAGAATAGTGAGGGATGCAGG - Intronic
1038234794 8:25742180-25742202 TAGAGAAGCGAGAAGGTGGATGG + Intergenic
1038432153 8:27509056-27509078 TAGAGAAAAAAGCAGGATGGGGG - Intronic
1038433920 8:27521472-27521494 TGGAGGACAGAGAAGGATGATGG + Intronic
1038854110 8:31312952-31312974 AAAAGAACAGAGCAGGATGAGGG + Intergenic
1039097788 8:33905100-33905122 AAGATAACAGAGAAGGAAGAAGG - Intergenic
1040446225 8:47497180-47497202 TAGAGAATAGAAAACAATAAAGG - Intronic
1040787273 8:51180464-51180486 TAGAGAGAAGATAAGGAGGAAGG - Intergenic
1041133908 8:54735503-54735525 TAGAGAATAGAGAATGATTGAGG + Intergenic
1042317573 8:67440148-67440170 TAGAGAATTCAGAAGGTGGATGG - Intronic
1042719517 8:71812276-71812298 GAGAGAAAGGAGAAGGCTGAAGG - Intergenic
1043086604 8:75842667-75842689 AAGATTATAGAGAAGGATTACGG - Intergenic
1043269418 8:78312088-78312110 TAGAGAATATACAAAGAAGATGG - Intergenic
1043277196 8:78413550-78413572 AAGAGAACAGAGAAGAATGGGGG - Intergenic
1043993746 8:86787740-86787762 TAGAGAATAGAAGAAGGTGATGG - Intergenic
1044725970 8:95194524-95194546 TAGAAAATAGGGGAAGATGAAGG + Intergenic
1044843571 8:96358974-96358996 CAGAGAATAGAGAACATTGAAGG - Intergenic
1044867377 8:96585520-96585542 AAGAGAAATGAGAAGGATGGGGG + Intronic
1045171503 8:99675544-99675566 GAGAGAATAGAGATAGATAAAGG - Intronic
1045193726 8:99908760-99908782 CAGAGAGAAGAGAAGGAGGAGGG + Intergenic
1046520676 8:115321060-115321082 AAGAGAATAGAGCAGGAAGAAGG - Intergenic
1046803208 8:118451593-118451615 TATAGAAAAGAGAGGGCTGATGG + Intronic
1047536831 8:125727580-125727602 AAGAGAATAGAGAGGGAAGTGGG + Intergenic
1048406457 8:134127479-134127501 TAAAGAAGAGAGGAGGATGTCGG + Intergenic
1049249298 8:141579668-141579690 TGGAGAAGAGAAAAGGATGCAGG - Intergenic
1049984997 9:942050-942072 CAGAGAATAAAGGAAGATGATGG - Intronic
1050304459 9:4294136-4294158 TAGAGACTAAAAAAGGATCAAGG - Intronic
1050898454 9:10913669-10913691 AAGAGAATAGAGAATGATTATGG + Intergenic
1051049741 9:12916938-12916960 TAGAGAACAGGGAAGCAAGATGG + Intergenic
1051074227 9:13210953-13210975 TTGAGAGAAGAGAAGGAAGAAGG - Intronic
1051235971 9:14999543-14999565 CTGTGAATAGAGAAGGAAGATGG + Intergenic
1051423884 9:16915379-16915401 CAGAGAAAAGAGATGGAAGAGGG - Intergenic
1052445972 9:28561806-28561828 AAGACAGTAGAGAAGGCTGAAGG + Intronic
1054730815 9:68701276-68701298 TAGAGATTTGGGAAGGATGCTGG + Intergenic
1054975489 9:71139034-71139056 TCTAGAGGAGAGAAGGATGAAGG - Intronic
1055087546 9:72329431-72329453 TAGGAATCAGAGAAGGATGAAGG - Intergenic
1056230923 9:84542656-84542678 AAGAGTATAGAGAGCGATGAAGG + Intergenic
1056813654 9:89783598-89783620 TAGAGAAGAGAGGAGGCTGGAGG + Intergenic
1056952749 9:91057644-91057666 TACAGAATATAGAAGGATGAAGG - Intergenic
1057370198 9:94464535-94464557 TAGAGTATCCAGAAGGAAGAAGG + Intergenic
1057815858 9:98294012-98294034 TAGAGAACACAGAGGGATAATGG - Intronic
1059286287 9:113174624-113174646 CAGAGAATAAAGAGGGATGATGG + Intronic
1059497043 9:114718583-114718605 TATAGAAAAGAGAAGAAAGAGGG - Intergenic
1059562625 9:115349939-115349961 AAGTGAATAGAGAAGGAAAAAGG + Intronic
1059588973 9:115637012-115637034 TAGAGCTTACAGAAGGAAGAGGG - Intergenic
1059695838 9:116729280-116729302 TAGAGCAGAGAGAAAAATGAGGG - Intronic
1059918231 9:119128147-119128169 TAGGGAGGAGAAAAGGATGAAGG - Intergenic
1060553720 9:124497842-124497864 TAGAAAGTAGAGAAGGTTCAGGG - Intronic
1060714182 9:125906484-125906506 TAGAGAAAAGGGAAAGAAGATGG + Intronic
1185482350 X:456361-456383 TAGATAATAAAGATGGGTGATGG - Intergenic
1185778454 X:2824963-2824985 TAGATAATAAATAATGATGATGG - Intergenic
1185814783 X:3144707-3144729 TAGAGAAAAGAGAGGGAAAAAGG - Intergenic
1187784083 X:22865021-22865043 TAGAAAATATAAAAGGATGATGG + Intergenic
1188148527 X:26644445-26644467 TACAGAATAAAGAAGAATTAAGG + Intergenic
1188468982 X:30515926-30515948 GAGAGAAGAGAGAAGCAAGAGGG - Intergenic
1188734574 X:33696689-33696711 TTGAAAAGAGAGAGGGATGAGGG + Intergenic
1188737588 X:33737986-33738008 TATAAAATAGGCAAGGATGATGG - Intergenic
1192234177 X:69285608-69285630 AAGAGAATGGAGAAGGGGGAAGG + Intergenic
1192540247 X:71963060-71963082 TAGAGAATAGAAAAAAATGGAGG - Intergenic
1192635844 X:72816419-72816441 TAGAGAATAGAAAACCATGGGGG - Intronic
1192645870 X:72904384-72904406 TAGAGAATAGAAAACCATGGGGG + Intronic
1193467015 X:81861817-81861839 TAGAGAAAAGAGAATGCTGATGG + Intergenic
1193582012 X:83276893-83276915 AAGAGAGCAGAGAAGGATCAAGG - Intergenic
1194033422 X:88842850-88842872 TAGAGGTTGCAGAAGGATGAAGG + Intergenic
1195089557 X:101445577-101445599 TGGAGATTAGAGAAGGGTGGAGG + Intronic
1195246698 X:103001613-103001635 TAGAGACTACAGCAGGAAGATGG + Intergenic
1195319477 X:103710031-103710053 TAGAGAATGGGGAATGAAGAGGG + Intronic
1195898707 X:109774629-109774651 TAGAGAATAGCTAAGCATGTAGG - Intergenic
1195917817 X:109952969-109952991 TACACACTAGAGAAGGATGTAGG - Intergenic
1196288428 X:113910719-113910741 GAGAGAAGAGAGAGAGATGAAGG - Intergenic
1196574611 X:117303308-117303330 AAGAGAATAGAGGAGGGTAATGG + Intergenic
1197254884 X:124252453-124252475 TAGAAAATAGAGCAGAATGAGGG + Intronic
1198193244 X:134332379-134332401 TAGAGAATAGAGTAGTAAGCCGG + Intergenic
1198746027 X:139891516-139891538 TAGAGAATAAACAATCATGATGG - Intronic
1198787769 X:140309122-140309144 TAGAGAATAGAGAAATAATAGGG + Intergenic
1198802217 X:140459567-140459589 TGGAGAATAGAGGAGGAGGAGGG + Intergenic
1199264549 X:145815924-145815946 TACAGAGTAGAGAAGGAACATGG - Intergenic
1199680836 X:150223577-150223599 GAGAGAAAAGAGAAGGAACATGG + Intergenic
1199899019 X:152154770-152154792 AAGAGAGTAGAGAAGGTTTAAGG - Intergenic
1199989958 X:152981779-152981801 TGTAGAATAGAGAAAGATGGTGG - Intergenic
1200274381 X:154717943-154717965 TTGAGCACAGAGAAGGATGACGG + Intronic
1200300614 X:154971027-154971049 AAGAGAATAATGAAGTATGAGGG - Intronic
1200384904 X:155880818-155880840 CAGGGAATAGAGATGGAAGAGGG + Intergenic
1202200995 Y:22347720-22347742 TCCAGAATACAGAAGGCTGAGGG + Intronic
1202273667 Y:23094715-23094737 AAGAGAAGAGAGAAGGAGGAAGG + Intergenic
1202292360 Y:23325966-23325988 AAGAGAAGAGAGAAGGAGGAAGG - Intergenic
1202426663 Y:24728460-24728482 AAGAGAAGAGAGAAGGAGGAAGG + Intergenic
1202444126 Y:24941626-24941648 AAGAGAAGAGAGAAGGAGGAAGG - Intergenic