ID: 1071779032

View in Genome Browser
Species Human (GRCh38)
Location 10:88822381-88822403
Sequence CTCAATACTCAAAGGGGGCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 123}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071779026_1071779032 20 Left 1071779026 10:88822338-88822360 CCATTCTGTACAAACATACGTAT 0: 1
1: 0
2: 1
3: 6
4: 168
Right 1071779032 10:88822381-88822403 CTCAATACTCAAAGGGGGCTGGG 0: 1
1: 0
2: 1
3: 18
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071779032 Original CRISPR CTCAATACTCAAAGGGGGCT GGG Exonic
903101635 1:21035417-21035439 CTCAATGCTCTCAGGGGCCTGGG + Intronic
906859170 1:49340698-49340720 CTCCATATTGAAACGGGGCTGGG + Intronic
908131299 1:61078125-61078147 CTCAATAGCCAGAGGGGGCGGGG + Intronic
909482825 1:76143835-76143857 CTCACTATTGAGAGGGGGCTTGG + Intronic
920861592 1:209712594-209712616 CTCAGTATTCAAAGGGGGATTGG - Intronic
923597947 1:235375471-235375493 CTGGATACTAAAATGGGGCTGGG + Intronic
1064018637 10:11791953-11791975 TTCAATATTTAAAGGGGGCCGGG + Intergenic
1065218129 10:23470405-23470427 CTAAGAAATCAAAGGGGGCTGGG - Intergenic
1066587130 10:36948026-36948048 CTCAATAATCAAACTGGCCTAGG - Intergenic
1067049858 10:43008901-43008923 CTTAATATTTAAAGGGGGCCGGG + Intergenic
1069562765 10:69442259-69442281 CTCATTACTCAGAAGGGCCTGGG - Intergenic
1070861505 10:79669367-79669389 CTCAAAACTAAAAGGAGGCTTGG + Intergenic
1070875741 10:79806222-79806244 CTCAAAACTAAAAGGAGGCTTGG - Intergenic
1071642669 10:87328361-87328383 CTCAAAACTAAAAGGAGGCTTGG - Intergenic
1071779032 10:88822381-88822403 CTCAATACTCAAAGGGGGCTGGG + Exonic
1072447713 10:95514030-95514052 CCCAATATTCAAAAGGGCCTGGG - Intronic
1074271691 10:111959979-111960001 CTCAATACTTAAAGGGTTCCAGG - Intergenic
1079362137 11:19777889-19777911 ATCAAGACACAATGGGGGCTCGG - Intronic
1082160686 11:48885051-48885073 CTCACTCCTCAAAGCAGGCTTGG - Intergenic
1082161680 11:48895355-48895377 CTCACTCCTCAAAGCAGGCTTGG + Intergenic
1082242388 11:49886928-49886950 CTCACTCCTCAAAGTAGGCTTGG + Intergenic
1082609805 11:55282791-55282813 CTCACTCCTCAAAGCAGGCTTGG - Intergenic
1082656876 11:55867733-55867755 CTCACTCCTCAAAGCAGGCTTGG + Intergenic
1082931235 11:58608147-58608169 CTAAACATTCAAAGGGGGATTGG + Intronic
1083313874 11:61802301-61802323 TTTAATACTCAGAGGGGGTTGGG - Exonic
1085079462 11:73622078-73622100 CTCAAAACTCAGTGAGGGCTGGG - Intergenic
1085901132 11:80701084-80701106 CTCAATAATCAAACTGGCCTAGG + Intergenic
1087216790 11:95503533-95503555 CTCAAAAATAGAAGGGGGCTGGG + Intergenic
1091440533 12:509204-509226 CTGAGCTCTCAAAGGGGGCTGGG - Intronic
1092684928 12:11032285-11032307 CTAAATTCTCAAAGGGAGCTTGG + Intronic
1092689606 12:11093177-11093199 CTAAATTCTCAAAGGGAGCTTGG + Intronic
1096278072 12:50227811-50227833 ATAAATACTCAGAGTGGGCTGGG - Intronic
1096781226 12:53993384-53993406 CTGAAGACTCAAAGGCTGCTAGG - Intronic
1098086295 12:66847778-66847800 CTCAAGACCCAATGGTGGCTGGG + Intergenic
1104685171 12:130780207-130780229 CTCAAAAAACAAAGGGTGCTGGG + Intergenic
1106002780 13:25740012-25740034 CTCAATAGAGAAAGAGGGCTGGG + Intronic
1106179273 13:27357167-27357189 AAAAATACTGAAAGGGGGCTGGG - Intergenic
1107456158 13:40556676-40556698 TTCAACACACAATGGGGGCTTGG + Exonic
1107525602 13:41228269-41228291 CTGAATAATAGAAGGGGGCTGGG + Intronic
1108000636 13:45902669-45902691 CTTAATACTCAGATGGAGCTGGG - Intergenic
1108526555 13:51290609-51290631 CAGAACACTCAAAGGGGGCTAGG - Intergenic
1109355040 13:61224510-61224532 CTTAATAATCAAAGGGGGAGAGG + Intergenic
1112798724 13:103087093-103087115 CTGAAAGCTCAACGGGGGCTGGG - Intergenic
1115738768 14:36364658-36364680 CTTAAGACTCACATGGGGCTGGG - Intergenic
1117282281 14:54252953-54252975 CTAAATACTCAATGGGTTCTAGG + Intergenic
1117499923 14:56341488-56341510 GTCAATACCCAAGGGGGACTGGG + Intergenic
1119524896 14:75315065-75315087 CTCAAAAGGCACAGGGGGCTGGG - Intergenic
1119645653 14:76346538-76346560 CTCAAGACACCATGGGGGCTTGG + Intronic
1120716335 14:87844913-87844935 AGCAATAATCAAAGGAGGCTGGG + Intronic
1121209805 14:92199733-92199755 CTCAATACTCAAACAGTCCTGGG + Intergenic
1124160338 15:27262518-27262540 CTCAATACTCAGATGGGGTAGGG - Intronic
1125488639 15:40129810-40129832 CTTAATATTCAAAGGCGGCGAGG - Intergenic
1125832583 15:42727464-42727486 CTCATTACTGAATGGGGGTTAGG - Intronic
1128347964 15:66866511-66866533 CTCCATCCTGAACGGGGGCTGGG + Intergenic
1130801817 15:87272518-87272540 CTCATCTCTGAAAGGGGGCTTGG + Intergenic
1131512312 15:93056137-93056159 CTCACTACTCAAAGTGGGCCGGG - Intronic
1134101640 16:11456721-11456743 CTCAAGACTCAAACTGGGCCAGG - Intronic
1135243872 16:20837337-20837359 CTAAATATTGAAAGGGGCCTTGG - Intronic
1139033136 16:62910284-62910306 CTAAATACTCAATGGTGCCTGGG + Intergenic
1141541081 16:84721989-84722011 GTCAAAACTCAAACTGGGCTGGG - Intronic
1142272621 16:89098504-89098526 CTCAACACTCAATGGGGGAAGGG - Intronic
1149527058 17:57364765-57364787 CTCAATCCCAAAAGGGAGCTTGG - Intronic
1150383114 17:64736213-64736235 CTCAAGAGTGAAATGGGGCTGGG + Intergenic
1150773130 17:68058563-68058585 CTCAAGAGTGAAATGGGGCTGGG - Intergenic
1152051020 17:77977578-77977600 CTGAATTCTCAAAGGGATCTGGG - Intergenic
1160877791 19:1305241-1305263 CTCAAAACTGAACGGAGGCTGGG + Intergenic
1161378489 19:3951942-3951964 CTCCATCCTCAGAGGGGGCTGGG + Intergenic
1161687541 19:5710728-5710750 CTCAATACTCACAGGTGGCCGGG + Intronic
1162099481 19:8331309-8331331 CTCATGCCTTAAAGGGGGCTGGG - Intronic
1166937769 19:46345186-46345208 ACAAATACTCAAAGTGGGCTGGG - Intergenic
1167254325 19:48418326-48418348 CTCAAAACTCACAGGTGGCTGGG - Intronic
927435302 2:23061290-23061312 CTCAAGAAACAAGGGGGGCTGGG - Intergenic
930202699 2:48560314-48560336 CTGAATTCTCAAAGGAAGCTGGG - Intronic
931369093 2:61645497-61645519 CTCAATTTTAAAATGGGGCTGGG + Intergenic
932106546 2:68948371-68948393 CTCAATAACCACAGGCGGCTGGG + Intronic
933571609 2:84020298-84020320 CTCATTAATCATCGGGGGCTTGG - Intergenic
937928355 2:127185113-127185135 GTCAAAACTCCATGGGGGCTGGG - Exonic
940399115 2:153226559-153226581 CTCAAGATTAAAATGGGGCTTGG - Intergenic
940471492 2:154105781-154105803 CTCAATATTCACATGGGGCTAGG - Intronic
941567626 2:167128563-167128585 CTCAATATCCAAGGGGGGATTGG - Intronic
941705174 2:168650593-168650615 ATAAATAGACAAAGGGGGCTGGG - Intronic
944896476 2:204170676-204170698 CACAATAGCCAGAGGGGGCTGGG - Intergenic
1169052049 20:2588013-2588035 GTCCATACTCAAAGGGGGGGGGG - Intronic
1169279821 20:4257408-4257430 CTCAATCCCCAAAGGGGGCAGGG - Intergenic
1172528881 20:35617315-35617337 CTCGATACTCAAACGGGGGCCGG - Intronic
1174325059 20:49772318-49772340 CTCACTACTCAAATGCAGCTTGG + Intergenic
1175149607 20:56923019-56923041 CTCACCACTCCAAGGGGACTTGG + Intergenic
1178804377 21:35826259-35826281 CTCAATACTGCAAGATGGCTGGG - Intronic
1179991199 21:44949069-44949091 CTCCAATCTCAAAGGGGGGTTGG - Intronic
1183696922 22:39428784-39428806 CTCCATCCTCAGAGTGGGCTGGG - Intronic
950461100 3:13122636-13122658 CTCAAAACTCAAAACGAGCTGGG + Intergenic
952926478 3:38323871-38323893 CTCAATACAAAAATGGGGCTAGG - Intergenic
953515279 3:43584879-43584901 CTCAAGACTGAAAGGTGGCCAGG - Intronic
954580086 3:51698553-51698575 CTCCATACTCATTGGGGGATGGG + Intronic
960460026 3:117922256-117922278 CTGAATACTCAAAGGGAGGAGGG - Intergenic
961070218 3:123917196-123917218 CTCAAAAATCAATGAGGGCTGGG + Intronic
961166398 3:124766707-124766729 CTCAAGCCTCAAAGGGGGCTGGG - Intronic
968256991 3:197284154-197284176 ATTAAAACTGAAAGGGGGCTGGG - Intronic
970221131 4:13812253-13812275 CTCCATCTTGAAAGGGGGCTGGG + Intergenic
972463190 4:39325928-39325950 TTCAAAACTCCAATGGGGCTGGG + Intronic
976548251 4:86363353-86363375 CTCAGTACTCTCAGGGGGATTGG - Intronic
977343715 4:95792026-95792048 CTCAGATCTCAAAGGGGGCTGGG - Intergenic
978420765 4:108530567-108530589 ATCAATTCTCAAAAGGTGCTTGG + Intergenic
979623511 4:122821760-122821782 TTAAATACTCACAGGAGGCTGGG - Intergenic
992963090 5:81974774-81974796 CTTAAAACTCAAAGGAAGCTTGG - Intronic
997527142 5:134560686-134560708 TTCAAAGCTCAAAGGAGGCTGGG + Intronic
999113657 5:149142581-149142603 CTCCAGACCCAAAGGTGGCTTGG - Intronic
1001114162 5:168924806-168924828 CTCAAAACTCAAATGCAGCTGGG - Intronic
1001470720 5:172010574-172010596 CCCCACACACAAAGGGGGCTGGG + Intergenic
1001724402 5:173884948-173884970 CTCAAACCCCAGAGGGGGCTGGG + Intergenic
1001913006 5:175536486-175536508 CTCAATACCCAAGGGAGGCCTGG + Intergenic
1002630330 5:180570593-180570615 CTCAATGCTGAAATGGGTCTTGG - Intronic
1003618994 6:7680878-7680900 CTCCATCTTGAAAGGGGGCTGGG - Intergenic
1008355358 6:50546522-50546544 CTCAAGATTTAGAGGGGGCTAGG + Intergenic
1008608904 6:53167716-53167738 ATAAAAAGTCAAAGGGGGCTGGG + Intergenic
1015076571 6:129166665-129166687 CTCATTACTCAAAAAGGGGTAGG - Intronic
1026117968 7:67512165-67512187 CTTAATAGTTAAAGGGGGCTGGG - Intergenic
1026243513 7:68597790-68597812 ATCAAGACTCAAATGTGGCTGGG - Intergenic
1029050729 7:97683945-97683967 CTCAAAACTCAAAGAAGGCTGGG + Intergenic
1032533877 7:132644612-132644634 ACCAATGCTGAAAGGGGGCTGGG - Intronic
1032860096 7:135868545-135868567 CTCAATAATCAAAGTTGGGTGGG + Intergenic
1033233980 7:139623780-139623802 CTCCAGAGTCAGAGGGGGCTGGG - Intronic
1034479068 7:151305958-151305980 TTCAACACTCTGAGGGGGCTGGG - Intergenic
1036206311 8:6807844-6807866 CTCAATAGTGAAAGTGGGCTGGG + Intergenic
1040404202 8:47084376-47084398 CAGAATACTCAAATGGGTCTTGG + Intergenic
1042863025 8:73332833-73332855 CTGAAAACCCAAAGGGGGCCAGG + Intergenic
1043758739 8:84037155-84037177 CTGAATAATAAAAGAGGGCTGGG - Intergenic
1045872096 8:106938957-106938979 CTAAATACACAAAAGGAGCTGGG - Intergenic
1047174709 8:122529376-122529398 CTCAAACGTCAAAGGGGACTTGG - Intergenic
1048072909 8:131040394-131040416 CTAAAGACTCAAAGGCGGCCTGG + Exonic
1048332265 8:133478881-133478903 CTCAATGCTCAGTGGAGGCTTGG + Intronic
1048386996 8:133921464-133921486 CTGAATATTCACAGAGGGCTTGG + Intergenic
1052325417 9:27212516-27212538 TGCAATACTCAAAAGGGGCCAGG - Intronic
1053040137 9:34863171-34863193 CTCTAGACTCACTGGGGGCTTGG + Intergenic
1056512468 9:87319006-87319028 CTCAATTCTCACAGTTGGCTGGG + Intergenic
1192212674 X:69137599-69137621 ATCAGTTCTCAAATGGGGCTGGG + Intergenic
1195668754 X:107451965-107451987 CTAAATAATCTAAGGGGGCGGGG - Intergenic
1196836863 X:119821500-119821522 CTCAAAACTCACAGCTGGCTGGG + Intergenic
1196983642 X:121243377-121243399 CTCAACACTCACTGAGGGCTAGG + Intergenic
1198035742 X:132799675-132799697 CTCAAAAATAAAAGAGGGCTGGG - Intronic
1199543154 X:148979874-148979896 CTCCTTTCGCAAAGGGGGCTGGG + Intronic
1201665480 Y:16448735-16448757 ATCAATACTCATGGTGGGCTGGG - Intergenic
1201991084 Y:20027093-20027115 CTCAATACTTTAAGAGGCCTAGG + Intergenic