ID: 1071782962

View in Genome Browser
Species Human (GRCh38)
Location 10:88867070-88867092
Sequence CTAAGATTCTAGAAACTTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071782962_1071782963 20 Left 1071782962 10:88867070-88867092 CCTGCAAGTTTCTAGAATCTTAG No data
Right 1071782963 10:88867113-88867135 TGAAAAAACACTTCTTCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071782962 Original CRISPR CTAAGATTCTAGAAACTTGC AGG (reversed) Intergenic
No off target data available for this crispr