ID: 1071782983

View in Genome Browser
Species Human (GRCh38)
Location 10:88867582-88867604
Sequence GGGCCTTATGGATCATCTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071782977_1071782983 11 Left 1071782977 10:88867548-88867570 CCCTTAAAGAATTATAGACTGTT No data
Right 1071782983 10:88867582-88867604 GGGCCTTATGGATCATCTTCTGG No data
1071782978_1071782983 10 Left 1071782978 10:88867549-88867571 CCTTAAAGAATTATAGACTGTTA No data
Right 1071782983 10:88867582-88867604 GGGCCTTATGGATCATCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071782983 Original CRISPR GGGCCTTATGGATCATCTTC TGG Intergenic
No off target data available for this crispr