ID: 1071784775

View in Genome Browser
Species Human (GRCh38)
Location 10:88886915-88886937
Sequence ACAGGATAAATAGAATCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071784775_1071784778 17 Left 1071784775 10:88886915-88886937 CCCTGTGATTCTATTTATCCTGT No data
Right 1071784778 10:88886955-88886977 TTAACACTAGAAATACAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071784775 Original CRISPR ACAGGATAAATAGAATCACA GGG (reversed) Intronic