ID: 1071784777

View in Genome Browser
Species Human (GRCh38)
Location 10:88886933-88886955
Sequence AATGATACAGTTGTAGTGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071784777_1071784780 15 Left 1071784777 10:88886933-88886955 CCTGTCACTACAACTGTATCATT No data
Right 1071784780 10:88886971-88886993 AGAGAGGCTGTTCTGCCTTTGGG No data
1071784777_1071784781 27 Left 1071784777 10:88886933-88886955 CCTGTCACTACAACTGTATCATT No data
Right 1071784781 10:88886983-88887005 CTGCCTTTGGGCTCATGCTTCGG No data
1071784777_1071784779 14 Left 1071784777 10:88886933-88886955 CCTGTCACTACAACTGTATCATT No data
Right 1071784779 10:88886970-88886992 CAGAGAGGCTGTTCTGCCTTTGG No data
1071784777_1071784778 -1 Left 1071784777 10:88886933-88886955 CCTGTCACTACAACTGTATCATT No data
Right 1071784778 10:88886955-88886977 TTAACACTAGAAATACAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071784777 Original CRISPR AATGATACAGTTGTAGTGAC AGG (reversed) Intronic