ID: 1071784777 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 10:88886933-88886955 |
| Sequence | AATGATACAGTTGTAGTGAC AGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 4 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1071784777_1071784781 | 27 | Left | 1071784777 | 10:88886933-88886955 | CCTGTCACTACAACTGTATCATT | No data | ||
| Right | 1071784781 | 10:88886983-88887005 | CTGCCTTTGGGCTCATGCTTCGG | No data | ||||
| 1071784777_1071784778 | -1 | Left | 1071784777 | 10:88886933-88886955 | CCTGTCACTACAACTGTATCATT | No data | ||
| Right | 1071784778 | 10:88886955-88886977 | TTAACACTAGAAATACAGAGAGG | 0: 1 1: 0 2: 0 3: 22 4: 257 |
||||
| 1071784777_1071784780 | 15 | Left | 1071784777 | 10:88886933-88886955 | CCTGTCACTACAACTGTATCATT | No data | ||
| Right | 1071784780 | 10:88886971-88886993 | AGAGAGGCTGTTCTGCCTTTGGG | No data | ||||
| 1071784777_1071784779 | 14 | Left | 1071784777 | 10:88886933-88886955 | CCTGTCACTACAACTGTATCATT | No data | ||
| Right | 1071784779 | 10:88886970-88886992 | CAGAGAGGCTGTTCTGCCTTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1071784777 | Original CRISPR | AATGATACAGTTGTAGTGAC AGG (reversed) | Intronic | ||