ID: 1071784778

View in Genome Browser
Species Human (GRCh38)
Location 10:88886955-88886977
Sequence TTAACACTAGAAATACAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071784777_1071784778 -1 Left 1071784777 10:88886933-88886955 CCTGTCACTACAACTGTATCATT No data
Right 1071784778 10:88886955-88886977 TTAACACTAGAAATACAGAGAGG No data
1071784776_1071784778 16 Left 1071784776 10:88886916-88886938 CCTGTGATTCTATTTATCCTGTC No data
Right 1071784778 10:88886955-88886977 TTAACACTAGAAATACAGAGAGG No data
1071784775_1071784778 17 Left 1071784775 10:88886915-88886937 CCCTGTGATTCTATTTATCCTGT No data
Right 1071784778 10:88886955-88886977 TTAACACTAGAAATACAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071784778 Original CRISPR TTAACACTAGAAATACAGAG AGG Intronic