ID: 1071784779

View in Genome Browser
Species Human (GRCh38)
Location 10:88886970-88886992
Sequence CAGAGAGGCTGTTCTGCCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071784777_1071784779 14 Left 1071784777 10:88886933-88886955 CCTGTCACTACAACTGTATCATT No data
Right 1071784779 10:88886970-88886992 CAGAGAGGCTGTTCTGCCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071784779 Original CRISPR CAGAGAGGCTGTTCTGCCTT TGG Intronic