ID: 1071784780

View in Genome Browser
Species Human (GRCh38)
Location 10:88886971-88886993
Sequence AGAGAGGCTGTTCTGCCTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071784777_1071784780 15 Left 1071784777 10:88886933-88886955 CCTGTCACTACAACTGTATCATT No data
Right 1071784780 10:88886971-88886993 AGAGAGGCTGTTCTGCCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071784780 Original CRISPR AGAGAGGCTGTTCTGCCTTT GGG Intronic