ID: 1071784781

View in Genome Browser
Species Human (GRCh38)
Location 10:88886983-88887005
Sequence CTGCCTTTGGGCTCATGCTT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071784777_1071784781 27 Left 1071784777 10:88886933-88886955 CCTGTCACTACAACTGTATCATT 0: 1
1: 0
2: 0
3: 9
4: 174
Right 1071784781 10:88886983-88887005 CTGCCTTTGGGCTCATGCTTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071784781 Original CRISPR CTGCCTTTGGGCTCATGCTT CGG Intronic
No off target data available for this crispr