ID: 1071788108

View in Genome Browser
Species Human (GRCh38)
Location 10:88925720-88925742
Sequence TCATTCTGCCAGCCAAAGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 164}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071788108 Original CRISPR TCATTCTGCCAGCCAAAGTC AGG (reversed) Intronic
901130210 1:6957817-6957839 TTATTCTGCCTGCCACAGGCAGG + Intronic
901139967 1:7022310-7022332 ACAGCCAGCCAGCCAAAGTCTGG - Intronic
901785914 1:11624799-11624821 TTATTCTGCCAGCCACAGTAAGG - Intergenic
903885070 1:26536372-26536394 TCATTCTGCCTGGCAAGGTCAGG + Intronic
904908667 1:33917453-33917475 ACATCCTGCAAGCCCAAGTCTGG + Intronic
906492515 1:46279320-46279342 TGGTTCTGCCAGCCATAGTTGGG - Intronic
914940299 1:152016996-152017018 TCATTCTGCCACAGAATGTCAGG + Intergenic
917531765 1:175842239-175842261 TAATTTTGCCAGTCAAACTCAGG - Intergenic
921406779 1:214788969-214788991 CCATTCTGGAACCCAAAGTCAGG - Intergenic
922617075 1:226967117-226967139 TCATTCTGACAGCAGAACTCAGG - Intronic
922871419 1:228904980-228905002 TTATTCTGCCTACCACAGTCTGG - Intergenic
922956798 1:229609553-229609575 TCATTCTGCCACTCAAAAACTGG + Intronic
923520151 1:234728978-234729000 TCTTCCTGCTAGCCAAAGGCTGG + Intergenic
924945851 1:248846582-248846604 TTGTTCTTCCAGCCCAAGTCTGG + Intronic
1067715944 10:48691252-48691274 TCAGTCTGCCACCCTAAGTCAGG - Intronic
1068989977 10:63140106-63140128 TCATTCTGTCACCCAGAGGCTGG - Intronic
1069641987 10:69962121-69962143 CCATTCTGCCAGGCGAAGGCAGG - Intronic
1070354699 10:75628683-75628705 CCCTTCTGCAAGCCAAAGCCAGG + Intronic
1070685643 10:78478384-78478406 CCAGTCTCCCAGCCTAAGTCTGG - Intergenic
1071788108 10:88925720-88925742 TCATTCTGCCAGCCAAAGTCAGG - Intronic
1074277818 10:112021678-112021700 TCATTCTGTCAGGAAAAGTGAGG + Intergenic
1080884093 11:36349587-36349609 TGTTTCTGCCTGCCAAAGACGGG - Intronic
1083409221 11:62480372-62480394 TCACTGTGCCTGGCAAAGTCAGG - Intronic
1084766508 11:71312543-71312565 TCCTTCTGCCAGCTAAGGTCTGG + Intergenic
1085823351 11:79816983-79817005 ACATGCTCCCAGCCAATGTCTGG + Intergenic
1086377694 11:86217886-86217908 ACATCCTGCCAGCAGAAGTCTGG - Intergenic
1087529788 11:99365097-99365119 TCAATTTGACAGCCAAACTCAGG - Intronic
1090087694 11:123665398-123665420 TCATTCTGAAATACAAAGTCCGG - Intergenic
1090330644 11:125929670-125929692 TCAATCTGCCAGCAGAATTCGGG - Intergenic
1092631907 12:10389267-10389289 TCTTTCTGCAAGCTAAACTCAGG + Intronic
1092969008 12:13673490-13673512 TCATTCTGGCAGCCATATTTTGG + Intronic
1097843503 12:64343872-64343894 TCAATCTACCAGCCAATGTGGGG + Intronic
1098465683 12:70783815-70783837 TCTTTTTGGCACCCAAAGTCTGG + Intronic
1098819764 12:75212368-75212390 TCATTCTGACAGTCACAGTGTGG - Intergenic
1098972594 12:76871835-76871857 TACTTCTTCCAGCCAAATTCAGG - Intronic
1099197192 12:79631298-79631320 TCATACTGCCAGTCCAAGCCAGG + Intronic
1103935503 12:124474476-124474498 TCATCCCACCAGCTAAAGTCTGG + Intronic
1104074751 12:125379119-125379141 TTATTCTGCCTACCAAAGGCAGG - Intronic
1104166881 12:126240154-126240176 TTATTCTGCCAACCAGAGTGTGG + Intergenic
1104203771 12:126617050-126617072 TCAATCTTCTAGCCAAAGTTTGG - Intergenic
1104621332 12:130315073-130315095 TCACTGTGCCAGTCAAAGTGTGG + Intergenic
1105026367 12:132851884-132851906 ACCTTCTGCCACCCAAACTCGGG + Intronic
1110346227 13:74450773-74450795 TCATTCTCCCAGGTAAAGACAGG - Intergenic
1116053123 14:39828941-39828963 TTATAATGCCACCCAAAGTCAGG + Intergenic
1117593199 14:57298182-57298204 TCATTATGCCAAACAAAATCAGG - Exonic
1120416109 14:84220476-84220498 TCATTTTGGTAGCGAAAGTCAGG - Intergenic
1120766621 14:88333237-88333259 TGATTCTTCCATGCAAAGTCTGG + Intergenic
1120841582 14:89090117-89090139 TCATTTTGCCCACCAAAGGCTGG + Intergenic
1120871075 14:89338036-89338058 TCATTCTTCAAGCCTAAGACAGG - Intronic
1124512169 15:30336632-30336654 TGATTCTGGCAGACAAAGTGAGG - Intergenic
1124730745 15:32194119-32194141 TGATTCTGGCAGACAAAGTGAGG + Intergenic
1127840970 15:62831405-62831427 TCATTCTGCCAAAGAATGTCAGG - Intronic
1130395044 15:83494193-83494215 TCCTCCTGCCACCCAAAGCCTGG - Intronic
1137635855 16:49986012-49986034 TCATGGGGCCAGCCAGAGTCGGG + Intergenic
1139016802 16:62699186-62699208 TCATTAGGCCCTCCAAAGTCTGG - Intergenic
1139822515 16:69731672-69731694 TCACTCTGCCACCCAAACTGGGG - Intergenic
1140908485 16:79430077-79430099 TCATTCTGGAAGCCAAAAACTGG + Intergenic
1141153527 16:81581107-81581129 TCATTCTGCCATCAAAAGGAAGG - Intronic
1141468731 16:84224041-84224063 TCCTTCTGCCACTCAAAGTGTGG + Intronic
1142283232 16:89160315-89160337 TCATTCTGCCACCCACAGATGGG - Intergenic
1143926666 17:10377213-10377235 TGATTCTGCCATGCAGAGTCAGG + Intergenic
1144085685 17:11806487-11806509 CCATTCTACCATCAAAAGTCTGG + Intronic
1144317922 17:14081585-14081607 TCAGTCAGCTAGCCAAAGCCAGG - Intronic
1145180459 17:20745561-20745583 ACATTCAGCCAGCCAAGCTCTGG - Intergenic
1147754647 17:42760674-42760696 TCAGTCCGCCAGCCAAAACCAGG - Intronic
1154069652 18:11141806-11141828 TCATTCTGCAACCCAAACTCAGG - Intronic
1157220103 18:45823336-45823358 TCACTCTGACAGCCACAGTGTGG + Intergenic
1157745466 18:50131296-50131318 TCTTCCTGGTAGCCAAAGTCTGG - Intronic
1159934630 18:74353384-74353406 TCAGTCAGCCAGCCAACATCAGG + Exonic
1163947326 19:20550948-20550970 TCAAACTCCCAGCCACAGTCTGG + Intronic
1168008218 19:53508248-53508270 TCATTCTGCCAGGAATGGTCAGG - Intergenic
926760642 2:16275914-16275936 TCATCCACCCAGCCAGAGTCTGG - Intergenic
926982825 2:18589897-18589919 TCATTCTGCCAGACAGACTTTGG + Intergenic
927718893 2:25370480-25370502 ACGTTATGCCAGCCAGAGTCAGG - Intergenic
929094050 2:38247195-38247217 TCTTTCTGCCTTCCAACGTCAGG - Intergenic
931082215 2:58786660-58786682 CCATTCTGACAGCCACAGACAGG - Intergenic
931439072 2:62274576-62274598 TCATTCTCTCAGCTAAAGTTTGG - Intergenic
931809350 2:65839454-65839476 TCAATCTACCAGCCACAGACTGG + Intergenic
934843959 2:97649728-97649750 TTATTCTGCCTGCCACTGTCTGG - Intergenic
939017286 2:136917544-136917566 CCATTAGGCCAGCCAGAGTCTGG - Intronic
939261292 2:139813486-139813508 ACATTCTCTCAGCCAAAGTGTGG + Intergenic
939584232 2:143987480-143987502 TAATTCTGCCTGGAAAAGTCAGG - Intronic
942411686 2:175716166-175716188 TTGTTCTACCAGCCAAAGTGTGG + Intergenic
942801304 2:179879324-179879346 TCACAATGCCAGACAAAGTCAGG - Intergenic
946615348 2:221503030-221503052 TCCTTCTTCCTGCTAAAGTCAGG - Intronic
947225693 2:227838290-227838312 TCATTCTCCCCGCCACTGTCAGG + Intergenic
948368549 2:237473801-237473823 TCCTCCTGCCAGCCAGGGTCTGG - Intergenic
1169058180 20:2641144-2641166 TCCCTCTGCCAGCCAAAGCCAGG + Exonic
1170013738 20:11757156-11757178 TCATTCTGTTGGCCAAAGGCAGG + Intergenic
1172248570 20:33463104-33463126 GCTTTGTACCAGCCAAAGTCAGG + Intergenic
1172834517 20:37864376-37864398 TCATCCTGCCAGCAAAACTTAGG - Intronic
1176345300 21:5738599-5738621 TCATTCTGCCAGAAATGGTCTGG + Intergenic
1176352114 21:5859183-5859205 TCATTCTGCCAGAAATGGTCTGG + Intergenic
1176499527 21:7585856-7585878 TCATTCTGCCAGAAATGGTCTGG - Intergenic
1176539621 21:8136669-8136691 TCATTCTGCCAGAAATGGTCTGG + Intergenic
1176558572 21:8319714-8319736 TCATTCTGCCAGAAATGGTCTGG + Intergenic
1178133827 21:29603651-29603673 TTATTTTGCAAGCCAAAGGCTGG + Intronic
1182558919 22:31143731-31143753 GAAGTCTGCCAGCCAATGTCTGG - Intergenic
1183552272 22:38496676-38496698 TCATTCTGCCAGTTTAAGTCAGG - Intronic
1183929978 22:41230326-41230348 TCAGTCTCCAAGCCAAAGTCAGG - Exonic
1184379843 22:44138412-44138434 TCCCTCTGCCAGCCAGGGTCAGG + Intronic
1185148067 22:49149974-49149996 TCAGCCTGCCAGACACAGTCAGG - Intergenic
1203244572 22_KI270733v1_random:53024-53046 TCATTCTGCCAGAAATGGTCTGG + Intergenic
952071552 3:29643194-29643216 TTAATCTGACAGCCACAGTCAGG + Intronic
956697404 3:71930199-71930221 ACATTATGCCAGACAGAGTCGGG + Intergenic
957124491 3:76141304-76141326 TAATACTGACAGCCAAAGTTAGG + Intronic
960487487 3:118271114-118271136 TAAATTTTCCAGCCAAAGTCAGG + Intergenic
960647111 3:119898305-119898327 TCATTAAGCCATCCTAAGTCGGG + Intronic
962737134 3:138336000-138336022 ACATTCTGCCACCCATAGCCTGG - Intergenic
963428453 3:145163194-145163216 TCATTCTGGCAGCCTGAGACAGG + Intergenic
969135917 4:5028745-5028767 GAATTCTGCCTGCCACAGTCAGG - Intergenic
970423868 4:15929039-15929061 TCATTCTGCCTCCCACTGTCTGG - Intergenic
970836598 4:20416281-20416303 GCCATCTGCAAGCCAAAGTCAGG - Intronic
971572745 4:28234179-28234201 TCATCCCCCCACCCAAAGTCAGG + Intergenic
971730263 4:30370211-30370233 TCTCTCTGCCAGCTAAGGTCTGG - Intergenic
971877942 4:32328398-32328420 TCATTCTGCCAGACAAAGGTGGG + Intergenic
972624619 4:40784624-40784646 TCATTCTCCCAGCCCATCTCAGG - Intronic
972975220 4:44626158-44626180 CAATTCTGCCAGCAAAAGTCAGG - Intronic
973154775 4:46936909-46936931 GCATTCTGCCATCCCTAGTCTGG - Intronic
975525015 4:75339446-75339468 TCATTCTGCCTACCAAAATGAGG + Intergenic
975904904 4:79197824-79197846 TGATTCTCCCAGCAAGAGTCAGG - Intergenic
979004659 4:115277318-115277340 TCATTCTGCCAATCTATGTCTGG - Intergenic
981925098 4:150130669-150130691 TCATTCTGCCAGCTGAACTGAGG + Intronic
982568282 4:157015010-157015032 ACTTTCTGGTAGCCAAAGTCTGG + Intergenic
985805645 5:2040749-2040771 TCACTCTGCCAGACAAAATCAGG - Intergenic
986562923 5:9081304-9081326 TCATTCAGTGAGTCAAAGTCTGG - Intronic
995257572 5:110064855-110064877 TCATTCTGCCTGTAAATGTCAGG - Intergenic
996383468 5:122885613-122885635 TCAGTCTGCCAGCTTAACTCTGG + Intronic
997607581 5:135186174-135186196 GCCTTCTGCCACCCAGAGTCTGG + Intronic
998069303 5:139184301-139184323 TCATACTGCTAGCCAGAGTAGGG - Intronic
1000300512 5:159952026-159952048 TCATTTTCCCAGCCAAATCCAGG - Intronic
1000385233 5:160669071-160669093 TCATTCTGCCAGCCTTTGGCTGG - Intronic
1005618053 6:27594146-27594168 CCAGTCTGCCAGCCAGTGTCGGG - Intergenic
1005891508 6:30143983-30144005 TTTTTCTGCCTGTCAAAGTCAGG - Intronic
1007121286 6:39384341-39384363 TCATTCTGCCTTCCCAAGCCTGG + Intronic
1007609493 6:43140080-43140102 TCACTCTGTCAGCCAGACTCTGG - Intronic
1011246945 6:85329375-85329397 GCATTCTGCCAGGCAGAGACAGG - Intergenic
1015166393 6:130204729-130204751 TCATTCTAAGAGCCAGAGTCAGG + Intronic
1016214804 6:141585690-141585712 TCACTCTACCAGCAAAAGCCTGG - Intergenic
1019664782 7:2246386-2246408 ACACTCTCCCAGCCAACGTCAGG - Intronic
1024788878 7:52939804-52939826 TCATTCAGCCAGTCCAATTCAGG - Intergenic
1026332690 7:69366478-69366500 TCAGTCTGTCCGTCAAAGTCAGG + Intergenic
1026936613 7:74260173-74260195 TCATTCTGGTTGCCAAAGGCGGG + Intergenic
1027739983 7:81989277-81989299 TCAGTCTGACACCCGAAGTCTGG - Intronic
1028350816 7:89845260-89845282 CCACTCTGCTAGCTAAAGTCAGG + Intergenic
1038358419 8:26853384-26853406 TCATTCTGCCAAGAAAACTCTGG - Intronic
1039662598 8:39483303-39483325 TCAATCTACCAGACAAAATCAGG - Intergenic
1040822200 8:51573966-51573988 TCATTCTGTCAGCCAAGGAAAGG + Intronic
1045770565 8:105733985-105734007 TCATTCTGCCAGCCAACATTAGG + Intronic
1046396810 8:113650981-113651003 TCCTTCTGCCAGCTGAGGTCTGG - Intergenic
1046830953 8:118745352-118745374 TCAGTGTTCCAGCCAAGGTCTGG + Intergenic
1047217125 8:122885249-122885271 TCATTCTGCTAGCTGAGGTCAGG - Intronic
1048387072 8:133921803-133921825 TGATGCTGCCAGCCAAGGGCAGG - Intergenic
1049147665 8:141013506-141013528 ACATTCTGGCAGGCCAAGTCTGG - Intergenic
1050490955 9:6187345-6187367 TCTTTCTTCCTCCCAAAGTCTGG - Intergenic
1057606234 9:96499469-96499491 GCATTTTGCCTGCCAAGGTCGGG - Intronic
1059377010 9:113890024-113890046 TCATTCAGCCAACTAATGTCAGG + Intronic
1060812844 9:126619595-126619617 TCACCCTGGCAGCCCAAGTCTGG + Intronic
1061713843 9:132506263-132506285 GCATGCTGCCACCCAAGGTCCGG + Intronic
1062055800 9:134469224-134469246 TCCTCCGGCCAGCCAAGGTCTGG - Intergenic
1062700734 9:137900361-137900383 TCACTCTGGCACCCAAGGTCGGG - Intronic
1203460904 Un_GL000220v1:36107-36129 TCATTCTGCCAGAAATGGTCTGG + Intergenic
1186133893 X:6498155-6498177 TCTTTCTATCAGCCAAAGTGGGG + Intergenic
1188168617 X:26892959-26892981 TCATCCTGCCAGCCATTGTCAGG + Intergenic
1192486285 X:71529742-71529764 TCATTCTTCCAATCCAAGTCTGG - Intronic
1198057401 X:133008500-133008522 TTATTCTGCCAACCACATTCAGG + Intergenic
1198575133 X:138002241-138002263 TCCTTCTATCTGCCAAAGTCAGG + Intergenic
1199056698 X:143304907-143304929 TCATTCTTCCAAACCAAGTCTGG - Intergenic
1200686765 Y:6265387-6265409 TCCTTCTGCCACCCCACGTCGGG + Intergenic
1200989643 Y:9336303-9336325 TCCTTCTGCCACCCCACGTCGGG + Intergenic
1200992312 Y:9356636-9356658 TCCTTCTGCCACCCCACGTCGGG + Intergenic
1200994963 Y:9376914-9376936 TCCTTCTGCCACCCCACGTCGGG + Intronic
1200997628 Y:9397260-9397282 TCCTTCTGCCACCCCACGTCGGG + Intergenic
1201000140 Y:9465796-9465818 TCCTTCTGCCACCCCACGTCGGG + Intergenic
1201002799 Y:9486106-9486128 TCCTTCTGCCACCCCACGTCGGG + Intronic
1201005455 Y:9506389-9506411 TCCTTCTGCCACCCCACGTCGGG + Intergenic
1201008118 Y:9526719-9526741 TCCTTCTGCCACCCCACGTCGGG + Intergenic
1201010728 Y:9546909-9546931 TCCTTCTGCCACCCCACGTCGGG + Intergenic