ID: 1071789397

View in Genome Browser
Species Human (GRCh38)
Location 10:88938419-88938441
Sequence TGCCTGCCTTCTAATGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 183
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 166}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071789394_1071789397 21 Left 1071789394 10:88938375-88938397 CCTGTCTGAGAGACAAAAGGGTC 0: 1
1: 0
2: 2
3: 12
4: 139
Right 1071789397 10:88938419-88938441 TGCCTGCCTTCTAATGAGGAAGG 0: 1
1: 0
2: 1
3: 15
4: 166
1071789391_1071789397 24 Left 1071789391 10:88938372-88938394 CCACCTGTCTGAGAGACAAAAGG 0: 1
1: 0
2: 1
3: 20
4: 178
Right 1071789397 10:88938419-88938441 TGCCTGCCTTCTAATGAGGAAGG 0: 1
1: 0
2: 1
3: 15
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071789397 Original CRISPR TGCCTGCCTTCTAATGAGGA AGG Intronic
901279511 1:8022892-8022914 AGCCTTCCATCTAATGAGGGAGG + Intronic
902489310 1:16769495-16769517 TGCCTGCTATAGAATGAGGAAGG + Intronic
902513402 1:16978009-16978031 TGCCTGCCTGCTGCTGTGGAAGG + Intronic
902541841 1:17161368-17161390 TGCATTCCATCTAATGAGAAGGG + Intergenic
903523106 1:23969926-23969948 TGCCTGCCTCTTTATGAGGGAGG - Intronic
906855873 1:49303814-49303836 TGCCTGCTTTTTAATGGGGTTGG + Intronic
909681454 1:78296003-78296025 TGCCTGACTTTTTATGAGGGAGG + Intergenic
916357740 1:163931910-163931932 TTCCTGTATGCTAATGAGGAGGG + Intergenic
916454921 1:164961259-164961281 TGCCTGCCCACTAATGATGATGG + Intergenic
916987398 1:170206587-170206609 TTCCTGCCTTCTTGTGAAGAAGG + Intergenic
920254256 1:204643716-204643738 TGACAGCCTTCTAATGATGAAGG + Intronic
922094874 1:222434788-222434810 GTTCTGCTTTCTAATGAGGATGG - Intergenic
922800218 1:228361693-228361715 TGACTGCCTTGGAGTGAGGAGGG + Intronic
923531128 1:234813030-234813052 TGCCTGCTATAGAATGAGGAAGG - Intergenic
923898404 1:238298858-238298880 TGGCTGCTGTCTAATCAGGATGG - Intergenic
924606877 1:245542671-245542693 TCGCTGCCTTCTAAGGAGGGTGG + Intronic
1066246761 10:33591435-33591457 TGGCTGAGTTCTAATGAGGCAGG - Intergenic
1066634802 10:37489906-37489928 TGTCTGCCTTCTGCTGAGAAAGG - Intergenic
1071175222 10:82918330-82918352 TGACAGTCTTCTAGTGAGGATGG - Intronic
1071789397 10:88938419-88938441 TGCCTGCCTTCTAATGAGGAAGG + Intronic
1071951435 10:90707386-90707408 CTCCTGCCTTCTTGTGAGGAAGG + Intergenic
1073261191 10:102191738-102191760 TGGCTGCTTCATAATGAGGAGGG - Intergenic
1073468237 10:103706895-103706917 TTCCTGCCTATTTATGAGGACGG + Intronic
1074227402 10:111498704-111498726 TGTCTGCCTGCTACTGAGAAAGG - Intergenic
1075861862 10:125683903-125683925 TGCCTCCCTTCTACTCAGTAAGG + Intergenic
1076204150 10:128581886-128581908 TGGCTGCTTACTACTGAGGATGG + Intergenic
1076784946 10:132745182-132745204 TGCCTGCCTGCCACAGAGGACGG + Intronic
1079427430 11:20356890-20356912 TGTCTTCTTTCTGATGAGGAGGG - Intergenic
1084718243 11:70887645-70887667 GGCCTCCCTGCTACTGAGGAGGG - Intronic
1085635686 11:78157868-78157890 AGCCTGCATTCAAATGTGGATGG - Intergenic
1085643287 11:78206980-78207002 CCCCTGCCTTCCAATGAGGGAGG - Intronic
1086210383 11:84311172-84311194 TGTCTTCCTTATAATGATGAAGG - Intronic
1086533898 11:87819816-87819838 TGCCTGGATTCTAATATGGATGG - Intergenic
1088591683 11:111408832-111408854 TCCCTACCTTCTAATGAGGGAGG + Intronic
1088992255 11:114963774-114963796 TGCCTCCTTTCTAGTGAGCATGG - Intergenic
1090295424 11:125583686-125583708 TGCCTGCCATCCAAAGGGGATGG + Exonic
1090495292 11:127205877-127205899 TGCCTGTCTTCTAGTGGTGAAGG - Intergenic
1092082731 12:5731204-5731226 TGCTTGCTTTCTGATGAGGGTGG + Intronic
1093042268 12:14396220-14396242 TGCTTGACTTCTAAAGAGGGAGG - Intronic
1093227791 12:16506352-16506374 TGCCTGCCATCTACTCTGGAAGG + Intronic
1093662325 12:21772076-21772098 TGCCAGCCTTTCAAGGAGGAAGG - Intronic
1099280079 12:80632796-80632818 TGCCTACCATCTAATAATGACGG - Intronic
1102344923 12:112153420-112153442 TCACTGCTTTCTAATGGGGAGGG + Exonic
1104039254 12:125118843-125118865 TGCCTGCCTTCTACCGTGGTCGG + Intronic
1104737676 12:131147787-131147809 TGGCTTCCTTCTAAACAGGATGG - Intergenic
1110156187 13:72319777-72319799 TTCCTGCCATCTTATGAAGAAGG + Intergenic
1110936992 13:81303930-81303952 TGCATGCCTTCAAATTAGGTGGG - Intergenic
1114577034 14:23724941-23724963 TGCCTGCCATCAACAGAGGAGGG + Intergenic
1115408931 14:33050508-33050530 TGCATACCTTCTAAAGGGGAGGG + Intronic
1117625356 14:57631552-57631574 TGCCTGCCTCGTTATGAGGGAGG + Intronic
1118555727 14:67018678-67018700 TGCCTACATTATAATGAGGAGGG + Intronic
1118563376 14:67112089-67112111 TGCCTACTTTTTAATGAAGATGG + Intronic
1121337234 14:93084884-93084906 TTCCTGCCTCTTGATGAGGAAGG - Intronic
1121434152 14:93907895-93907917 TGCCTGCCATCACATGTGGAGGG - Intergenic
1123696705 15:22883925-22883947 TTCCTGCCTTCTTGTGAAGAAGG - Intronic
1124610139 15:31202477-31202499 TGCCTGACTTCTCCTTAGGATGG + Intergenic
1125327804 15:38554603-38554625 GGTCTGCCTTCTCATGAGCATGG - Intronic
1125793196 15:42385466-42385488 GAGCTGCCTTCTAAGGAGGATGG - Intronic
1126281771 15:46960895-46960917 TGCCTGCCCTCTATCGATGAAGG - Intergenic
1127202480 15:56671004-56671026 TGCCCGCTTTCTAATGGGGTTGG + Intronic
1127538567 15:59914663-59914685 TGCCTGCTTTTTACAGAGGATGG + Intergenic
1132253404 15:100351720-100351742 TGCCTGGCTTCTGATGAATAGGG + Intergenic
1132264817 15:100460649-100460671 AGCTTGCCTGCTAGTGAGGAGGG - Intronic
1134311509 16:13079315-13079337 TTCCTGTGTTCTTATGAGGAAGG + Intronic
1135407844 16:22210849-22210871 TGCCTGCCTTCTAGGGAGCTGGG + Intronic
1138309791 16:56013638-56013660 TTGCTTCCTTCTAATTAGGATGG + Intergenic
1139278917 16:65752908-65752930 TGCCTGTCTTCTAATTATTAAGG + Intergenic
1145264207 17:21371762-21371784 TGCCTGCCTCCTGATGGGGCAGG + Intergenic
1146181544 17:30701447-30701469 TGCCTGGCTTCTTTTGAGCATGG + Intergenic
1146514115 17:33475567-33475589 TGACTTCCTTCTAATGATGGGGG + Intronic
1147534890 17:41314176-41314198 TGCCTGAGTTCTAAGGAGGAGGG - Intergenic
1147544246 17:41387857-41387879 TGCCTGTCTTAGAATGCGGATGG - Intronic
1148638666 17:49168746-49168768 GGCCTGCCTTCACAAGAGGATGG + Exonic
1148991832 17:51672885-51672907 TGGCTGCTTTCTAGTGGGGAGGG + Intronic
1149021212 17:51967018-51967040 TGCCTGCTTTTTAATGGGGTTGG - Intronic
1149120358 17:53156074-53156096 TGCCTACTTTTTAATGAGGTTGG + Intergenic
1149560168 17:57603002-57603024 TCCCTTCCTTCTGATGATGATGG - Intronic
1151329006 17:73395800-73395822 TGCCTGCCTTTGAGTGAGCATGG + Intronic
1155061261 18:22230930-22230952 TGCATTCCTTCAAATGAGTAAGG + Intergenic
1157506736 18:48231704-48231726 TGCCTGCAATATAATGAGCAAGG - Intronic
1157863185 18:51159947-51159969 TTCCTGCCTTCTAAGAAGGGTGG + Intergenic
1159889809 18:73943006-73943028 TGACTGCCTCCTAATTAGGATGG + Intergenic
1160048739 18:75411898-75411920 TGCATGCCTTCTATAGAGCAGGG - Intronic
925653463 2:6117810-6117832 TTCCTGCCACCTAGTGAGGAAGG - Intergenic
925871519 2:8275929-8275951 TGCCTTCTTTGTAATGAGGTAGG + Intergenic
926222126 2:10943197-10943219 TGCCTGCCTTGGCAGGAGGAAGG + Intergenic
927582719 2:24268366-24268388 TTCCTGCCCTCTAATGACAAAGG + Intronic
931716969 2:65037097-65037119 TGCCTGCCATCTACTGCGGCTGG + Intergenic
931876945 2:66524205-66524227 TGCCTGCTTTGTCATGAGCAAGG - Intronic
932214953 2:69960673-69960695 TGCCGCCCTTCTTCTGAGGAGGG + Exonic
934758351 2:96839821-96839843 TGCCTGCGTTCTCAGCAGGAAGG - Exonic
935727295 2:106034836-106034858 TGACTTCCTTCCAATGAGTACGG + Intergenic
936157073 2:110054734-110054756 TGCCTGCCTTCTGCTGAGCTAGG + Intergenic
936187621 2:110316710-110316732 TGCCTGCCTTCTGCTGAGCTAGG - Intergenic
936270077 2:111042577-111042599 GGCCTGCCTTATCAGGAGGAAGG + Intronic
937848364 2:126607281-126607303 TGCCTGCTTTTTAATGGGGTTGG - Intergenic
942089939 2:172480189-172480211 TGTCTCCCTTTTAATCAGGAGGG + Intronic
944507019 2:200423241-200423263 TTCCTGCCTTCAAATTATGAAGG + Intronic
946940494 2:224764764-224764786 TGCTTGCCTTCAAAAGAGGCAGG + Intergenic
947849112 2:233270598-233270620 TGCCTGCCATGTAATGCGGTGGG + Intronic
948642950 2:239386913-239386935 TCGCTGCCACCTAATGAGGAAGG - Intronic
1169020951 20:2330469-2330491 TGCCTGCCTTCTTTTTAGCAGGG + Intronic
1172819830 20:37722073-37722095 TCCCTGATTTCTAATGAGGTTGG + Intronic
1173867864 20:46323998-46324020 TGCTTCCCTTCTAAGGAGGAAGG + Intergenic
1174257786 20:49271132-49271154 TGCCTGCCTGCTTATGTGGTAGG - Exonic
1177880016 21:26681876-26681898 TGGCTGCATTATAGTGAGGAAGG - Intergenic
1179036373 21:37762168-37762190 GGCCTGTCTACTAATGAGAAAGG - Intronic
1180026476 21:45165162-45165184 TGCATCCCTTTTAGTGAGGAAGG + Intronic
1180592729 22:16955099-16955121 CCCCTGCCTTCAAATGAGAAAGG - Intergenic
1182379161 22:29872428-29872450 TCCCTGCCACCCAATGAGGAAGG - Intergenic
1184147999 22:42622719-42622741 TGCATGCCCTCTACTGATGAGGG - Intronic
950009421 3:9712395-9712417 TGAGTGCCTTCTGGTGAGGAAGG - Intronic
950514372 3:13454635-13454657 TACCTGCCTCCTAAGGAGGAAGG + Intergenic
951053578 3:18122108-18122130 TTCCTGCCTTCCAATGAGCAGGG - Intronic
953159089 3:40401516-40401538 TGCCTGCCTTTTGCTGTGGAGGG + Intronic
953213522 3:40897253-40897275 TGCCTGCCTTACACTGAGGGGGG + Intergenic
953350779 3:42214208-42214230 TGACACCCTTCTAATGTGGAGGG + Intronic
954967171 3:54622151-54622173 TGCCTGCTGTGAAATGAGGATGG - Intronic
955047496 3:55373882-55373904 TACCTGGCATCTTATGAGGATGG - Intergenic
955931044 3:64057217-64057239 TGCCAGTGTTCCAATGAGGATGG - Intergenic
956663039 3:71617891-71617913 GGCCTGTGTTCTAATGAGAACGG + Intergenic
958638419 3:96775813-96775835 TGCCTGCTTTCTAATGTGTTTGG - Intergenic
960846214 3:122006624-122006646 TGCCTGCATTCTAAGGTGGTGGG + Intronic
970897606 4:21121515-21121537 TGCATGCCTTCTCATTTGGAAGG + Intronic
974303666 4:60103467-60103489 TGTATGTCTTTTAATGAGGAAGG + Intergenic
974380132 4:61128869-61128891 TGCCTACCATTGAATGAGGAAGG + Intergenic
981360303 4:143838465-143838487 TGTGTGCCTTCTTTTGAGGAAGG + Intergenic
981371072 4:143959532-143959554 TGTATGCCTTCTTTTGAGGAAGG + Intergenic
982193473 4:152883233-152883255 ACCCTGCCTTCTAGTGAGTAGGG + Intronic
982908166 4:161104259-161104281 TGCATGGCTTCTGATGAGGAGGG + Intergenic
983284990 4:165727866-165727888 AGGCTGCCTTCTAATGAGGATGG - Intergenic
984576145 4:181450682-181450704 TCTATGCCTTCTACTGAGGAAGG - Intergenic
986827238 5:11534720-11534742 TGACAACCTTCTAAAGAGGAAGG - Intronic
988934991 5:36072837-36072859 TGCATGTCTTCTTATGAGAAGGG + Intergenic
993880765 5:93358085-93358107 GTGCTGCCTTCTAATGAGGCTGG - Intergenic
997210890 5:132076215-132076237 TGCCTGCCTTCCCATGAGGCAGG + Intergenic
997823294 5:137084919-137084941 CTCTTGCCTTCTGATGAGGATGG - Intronic
998590706 5:143474906-143474928 TGACTTCCTTCTAGAGAGGATGG - Intergenic
999748929 5:154611700-154611722 CGCCTTCCTTCTCACGAGGAGGG + Intergenic
999947868 5:156617082-156617104 AGCTTACATTCTAATGAGGAAGG - Intronic
1005105336 6:22218583-22218605 TGCCTGGCTTCGAAGGTGGAAGG + Intergenic
1010214731 6:73391531-73391553 TGTCTGCCTGCTACTGAGTAAGG - Intronic
1011184960 6:84663946-84663968 TGGCTGTCTTATAGTGAGGAGGG - Intergenic
1013140837 6:107332978-107333000 CGCTTGCTTGCTAATGAGGAAGG + Intronic
1017268861 6:152482708-152482730 TGCCTGCCTTCCTTTGAGAATGG + Intronic
1021366000 7:19778663-19778685 TCACTGCCTTCTAATTAGAATGG - Intergenic
1021566691 7:22023596-22023618 TTCCCAGCTTCTAATGAGGAAGG - Intergenic
1021929049 7:25561599-25561621 TTCCTGCCATCAAATCAGGAAGG + Intergenic
1023743997 7:43304892-43304914 TGCCTGCCTTCTAAGTAGAGGGG + Intronic
1028869894 7:95758295-95758317 TGCTTTCCTGCTAATGATGAGGG - Intergenic
1030279466 7:107757060-107757082 TGCCAGCCTTATAGTAAGGATGG + Intronic
1033968802 7:147011807-147011829 TGGCTGCCATCAAACGAGGAAGG - Intronic
1038592678 8:28854677-28854699 TGCCTGCTTCCTCAGGAGGAGGG - Intronic
1039569982 8:38578994-38579016 TGCCTGCCTTCTGGTGAACAAGG + Intergenic
1039740469 8:40378316-40378338 TGGCAGCCTTCTTATGAGGCTGG + Intergenic
1040574101 8:48635798-48635820 TGCCTGCAGTCTCATGAGGGGGG - Intergenic
1040844054 8:51817238-51817260 TCCCTCCCTTCTCAGGAGGAGGG - Intergenic
1041179073 8:55229158-55229180 TGCCTGCCTTACAAACAGGATGG - Intronic
1041724337 8:61004360-61004382 TGCCTGCATTCCTTTGAGGAAGG - Intergenic
1042211958 8:66389871-66389893 TGCCTGCCTCCAACTGAGGTTGG - Intergenic
1044107545 8:88229994-88230016 TGCTTTACTTCTAATGAGAAGGG - Intronic
1045605442 8:103768496-103768518 TGTCCGCCTGCTAATGAGTAAGG + Intronic
1050268661 9:3918397-3918419 TGCTTGCCTTTTGATCAGGAGGG - Intronic
1050324239 9:4484794-4484816 TTCCTGACCTCCAATGAGGAAGG - Intergenic
1053087314 9:35236696-35236718 TGCATGCCCTCTAATTAGAAAGG - Intronic
1055219179 9:73907713-73907735 AGCTTACCTTCTAGTGAGGAGGG + Intergenic
1055484766 9:76746315-76746337 TGCCTGCCTTCTCCCGAGGTTGG - Intronic
1057517808 9:95736797-95736819 CGCCTGCCTTTTAATGAGCAAGG + Intergenic
1058348735 9:103996227-103996249 TGCCTGCCTTCAAAGGACAAAGG - Intergenic
1059340569 9:113595297-113595319 TGCCTGCCATCTCATGGGCAGGG + Intronic
1060779183 9:126399250-126399272 TGACTGTCTTCTAGTGAAGAAGG + Intronic
1060898831 9:127239292-127239314 TCCCAGCTTTCTAATGAGAAAGG - Intronic
1061639129 9:131937542-131937564 TGCCTGCCTTCTCAGGTGGAAGG + Intronic
1062081681 9:134627451-134627473 TCCCTCCCTTGTAAGGAGGAGGG - Intergenic
1186123127 X:6384348-6384370 TGTCTCCCTACTAATCAGGAGGG + Intergenic
1188717660 X:33480069-33480091 TGCCTGCTTTCTCATGAGTGAGG - Intergenic
1188925139 X:36031801-36031823 TGCCTCTCTTCTAATTAGGAAGG + Intergenic
1190325577 X:49205072-49205094 TGCCTGCCTCCTGCTGGGGAGGG + Exonic
1191943093 X:66500872-66500894 TAACAGCCTTCTAAAGAGGATGG - Intergenic
1193317017 X:80076554-80076576 GGCCTGCCTAATAATGAGCAGGG + Intergenic
1196055223 X:111348384-111348406 TGCCAGCCTTCCAATCAGGCTGG - Intronic
1196390506 X:115203132-115203154 TGCCTGCCATCTTGTGAAGAAGG - Intronic
1201885688 Y:18879769-18879791 TGACTGGCTTCTATTGAGGATGG + Intergenic