ID: 1071794354

View in Genome Browser
Species Human (GRCh38)
Location 10:88989641-88989663
Sequence CTGTTTGGGCCCTCAAATCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071794354_1071794360 16 Left 1071794354 10:88989641-88989663 CCTAGATTTGAGGGCCCAAACAG No data
Right 1071794360 10:88989680-88989702 TCAACTGAGAGGAAGCCTGAAGG No data
1071794354_1071794361 27 Left 1071794354 10:88989641-88989663 CCTAGATTTGAGGGCCCAAACAG No data
Right 1071794361 10:88989691-88989713 GAAGCCTGAAGGATGAACAGTGG No data
1071794354_1071794362 28 Left 1071794354 10:88989641-88989663 CCTAGATTTGAGGGCCCAAACAG No data
Right 1071794362 10:88989692-88989714 AAGCCTGAAGGATGAACAGTGGG No data
1071794354_1071794359 5 Left 1071794354 10:88989641-88989663 CCTAGATTTGAGGGCCCAAACAG No data
Right 1071794359 10:88989669-88989691 AGAAGAAAATGTCAACTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071794354 Original CRISPR CTGTTTGGGCCCTCAAATCT AGG (reversed) Intronic