ID: 1071797534

View in Genome Browser
Species Human (GRCh38)
Location 10:89022447-89022469
Sequence AAGAAGTAGATAAATGAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071797534_1071797537 11 Left 1071797534 10:89022447-89022469 CCCTCTTCATTTATCTACTTCTT No data
Right 1071797537 10:89022481-89022503 CATATATTTGCTTGCCAAACTGG No data
1071797534_1071797538 22 Left 1071797534 10:89022447-89022469 CCCTCTTCATTTATCTACTTCTT No data
Right 1071797538 10:89022492-89022514 TTGCCAAACTGGTAGTGACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071797534 Original CRISPR AAGAAGTAGATAAATGAAGA GGG (reversed) Intergenic
No off target data available for this crispr