ID: 1071798258

View in Genome Browser
Species Human (GRCh38)
Location 10:89029109-89029131
Sequence CGAAACGAAGGTCTTGCTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071798256_1071798258 -4 Left 1071798256 10:89029090-89029112 CCAAGGATCTGAAATCTCACGAA No data
Right 1071798258 10:89029109-89029131 CGAAACGAAGGTCTTGCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071798258 Original CRISPR CGAAACGAAGGTCTTGCTAA AGG Intergenic