ID: 1071800226

View in Genome Browser
Species Human (GRCh38)
Location 10:89051671-89051693
Sequence ATGTCTTCTAAGGCTCTTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071800226_1071800232 16 Left 1071800226 10:89051671-89051693 CCAAGAAGAGCCTTAGAAGACAT No data
Right 1071800232 10:89051710-89051732 CCAGTATCCAGGTGGGATCCTGG No data
1071800226_1071800228 5 Left 1071800226 10:89051671-89051693 CCAAGAAGAGCCTTAGAAGACAT No data
Right 1071800228 10:89051699-89051721 CAAAATATAATCCAGTATCCAGG No data
1071800226_1071800230 9 Left 1071800226 10:89051671-89051693 CCAAGAAGAGCCTTAGAAGACAT No data
Right 1071800230 10:89051703-89051725 ATATAATCCAGTATCCAGGTGGG No data
1071800226_1071800229 8 Left 1071800226 10:89051671-89051693 CCAAGAAGAGCCTTAGAAGACAT No data
Right 1071800229 10:89051702-89051724 AATATAATCCAGTATCCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071800226 Original CRISPR ATGTCTTCTAAGGCTCTTCT TGG (reversed) Intergenic
No off target data available for this crispr