ID: 1071800230

View in Genome Browser
Species Human (GRCh38)
Location 10:89051703-89051725
Sequence ATATAATCCAGTATCCAGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071800227_1071800230 -1 Left 1071800227 10:89051681-89051703 CCTTAGAAGACATAACAACAAAA No data
Right 1071800230 10:89051703-89051725 ATATAATCCAGTATCCAGGTGGG No data
1071800226_1071800230 9 Left 1071800226 10:89051671-89051693 CCAAGAAGAGCCTTAGAAGACAT No data
Right 1071800230 10:89051703-89051725 ATATAATCCAGTATCCAGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071800230 Original CRISPR ATATAATCCAGTATCCAGGT GGG Intergenic
No off target data available for this crispr