ID: 1071815181

View in Genome Browser
Species Human (GRCh38)
Location 10:89225117-89225139
Sequence ACTAGCCCTATGGCCAAATT AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 69
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 66}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071815181_1071815187 9 Left 1071815181 10:89225117-89225139 CCTAATTTGGCCATAGGGCTAGT 0: 1
1: 0
2: 0
3: 2
4: 66
Right 1071815187 10:89225149-89225171 GACGGAAGCCACAGGACCCAGGG 0: 1
1: 0
2: 6
3: 15
4: 174
1071815181_1071815185 1 Left 1071815181 10:89225117-89225139 CCTAATTTGGCCATAGGGCTAGT 0: 1
1: 0
2: 0
3: 2
4: 66
Right 1071815185 10:89225141-89225163 CAGAAGGCGACGGAAGCCACAGG 0: 1
1: 0
2: 0
3: 8
4: 94
1071815181_1071815186 8 Left 1071815181 10:89225117-89225139 CCTAATTTGGCCATAGGGCTAGT 0: 1
1: 0
2: 0
3: 2
4: 66
Right 1071815186 10:89225148-89225170 CGACGGAAGCCACAGGACCCAGG 0: 1
1: 0
2: 2
3: 10
4: 105
1071815181_1071815184 -9 Left 1071815181 10:89225117-89225139 CCTAATTTGGCCATAGGGCTAGT 0: 1
1: 0
2: 0
3: 2
4: 66
Right 1071815184 10:89225131-89225153 AGGGCTAGTACAGAAGGCGACGG 0: 1
1: 0
2: 1
3: 5
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071815181 Original CRISPR ACTAGCCCTATGGCCAAATT AGG (reversed) Exonic
904978351 1:34476032-34476054 ACAAGCCCTGGGGCAAAATTAGG + Intergenic
908889159 1:68823590-68823612 TCAAGCCTTATGGCCAAGTTAGG - Intergenic
911171551 1:94775566-94775588 ACTAGCCCTATGGTTAAAGCTGG - Intergenic
911408801 1:97475728-97475750 ACTAGGCTGGTGGCCAAATTTGG + Intronic
912104203 1:106250200-106250222 ACTAGACATATTGCCAAATGAGG + Intergenic
913362189 1:117993580-117993602 CCTAGCCCTGTGGTTAAATTTGG - Intronic
924363048 1:243261092-243261114 ATGAGGCTTATGGCCAAATTGGG + Intronic
1066223923 10:33363773-33363795 AAAAGCCCTATGGCTACATTTGG + Intergenic
1068204047 10:53824442-53824464 ACTAGCCATATTGAAAAATTAGG + Intronic
1071815181 10:89225117-89225139 ACTAGCCCTATGGCCAAATTAGG - Exonic
1073369487 10:102974373-102974395 ACTAGCTTTATGGTCAAAATAGG - Intronic
1074713495 10:116197620-116197642 ACTAACCCTATTTCCAAATGAGG + Intronic
1078846013 11:15119105-15119127 ACTACTCCTTTGGGCAAATTGGG + Intronic
1079940708 11:26677093-26677115 GCTAGCCCTAAGGCCTCATTTGG + Intronic
1084602336 11:70153364-70153386 TATAGCCCTTTGGCCAAATCTGG - Intronic
1091596408 12:1881839-1881861 ATAAGCCATCTGGCCAAATTTGG - Intronic
1101427476 12:104599800-104599822 TCTAGCCCAAGGGCCAAATCTGG + Intronic
1101959974 12:109241640-109241662 CCTGGCCATATGGCCATATTTGG + Intronic
1102493824 12:113305601-113305623 ATCAGCCCTCCGGCCAAATTTGG + Intronic
1104149973 12:126072980-126073002 GACAGCCCTATGGCCAAATCTGG + Intergenic
1111247937 13:85566203-85566225 ACAAGCCCTATTACCAAATCTGG + Intergenic
1111742952 13:92227320-92227342 CCTAATCCTATGGCCACATTGGG - Intronic
1113329673 13:109316128-109316150 ACAAGCACTATGTCCAAATTAGG - Intergenic
1115266248 14:31503702-31503724 GCTGTCCCTATGCCCAAATTAGG - Intronic
1132406580 15:101545009-101545031 AGCAGCTCTAGGGCCAAATTTGG - Intergenic
1135530433 16:23248458-23248480 ACATGCCCTAGGGCCAGATTTGG - Intergenic
1145997409 17:29112620-29112642 ACTAGGCCTGTGGCCACATCTGG + Intronic
1146317062 17:31815654-31815676 ACTAGTCCTATTGCCACAGTAGG + Intergenic
1147897847 17:43762889-43762911 AATAGCCCTATTTCCAAATAAGG + Intergenic
1148473016 17:47907213-47907235 CCTACCCCTTTGGCCAAACTTGG - Intronic
1148550263 17:48546042-48546064 ACTAGCACAATGGCAAAAATGGG - Intergenic
1155640912 18:28013651-28013673 ACCAGCCCTAAAGCCATATTCGG + Intronic
1157035577 18:43969207-43969229 ACTAGCCCATAGGTCAAATTAGG - Intergenic
1166629139 19:44389903-44389925 ACAGGACCTAGGGCCAAATTAGG + Intronic
929913981 2:46118331-46118353 ACAAGCTCTTTGGCCAACTTTGG - Intronic
931158974 2:59667138-59667160 AATACCCCTATTTCCAAATTAGG + Intergenic
931864746 2:66397353-66397375 ACTGGCTCTATGGCCAATGTTGG - Intergenic
939301005 2:140338473-140338495 TCTCAACCTATGGCCAAATTAGG + Intronic
943988693 2:194657764-194657786 ACTAGACCAAATGCCAAATTAGG + Intergenic
947396034 2:229687784-229687806 ATTAGCCTTATGTCTAAATTTGG - Intronic
1169267170 20:4173891-4173913 CCTAGCCCTGGGGCCAGATTTGG + Intronic
1173150678 20:40564172-40564194 ACCAGCCCTTGGGCCAAATCTGG - Intergenic
1183007295 22:34914033-34914055 ACAAGCCCTACTGCCAAAATTGG + Intergenic
949168995 3:976245-976267 TTCAGCCCTAGGGCCAAATTTGG - Intergenic
949549934 3:5104316-5104338 TCTAGCCCTATGGCCCAGTCTGG + Intergenic
951571177 3:24064838-24064860 TCCAGCCCTATGTCAAAATTTGG - Intergenic
952024124 3:29057877-29057899 ACTTGCCCTAGGGTCACATTTGG - Intergenic
953021263 3:39114858-39114880 AATTGTGCTATGGCCAAATTGGG + Intronic
965802154 3:172505376-172505398 AATGGCCCTATGTCCAAATAAGG + Intergenic
966643610 3:182217913-182217935 ACTAGCCCTAGGATCAAACTTGG - Intergenic
970740419 4:19231001-19231023 ACCAGCCCTATGGGCATCTTAGG - Intergenic
978071556 4:104478492-104478514 ATTAGACCTATGGCCAAAATGGG - Intronic
999885132 5:155914091-155914113 ACTAGCACTGAGACCAAATTTGG - Intronic
1000549579 5:162643710-162643732 ACTTGCCCTTTGGCCAGAGTAGG + Intergenic
1005852829 6:29835028-29835050 ACTGGGCCTGTGGCCAAATGAGG + Intergenic
1005876433 6:30013535-30013557 ACTGGGCCTGTGGCCAAATGAGG + Intergenic
1006649581 6:35539867-35539889 TATAGCCCTGGGGCCAAATTTGG + Intergenic
1006766482 6:36510958-36510980 ACTAGCCCTAAGGAAAAAGTAGG + Intronic
1009974424 6:70657893-70657915 ACTAGGCATGTGACCAAATTAGG - Intergenic
1023776684 7:43614590-43614612 AATAGCCCTGTGGTCAAAATTGG + Intronic
1030136040 7:106249743-106249765 TATAGCCCAAAGGCCAAATTTGG - Exonic
1032027438 7:128454921-128454943 ACCAGCCTTATGTCCAGATTTGG - Intergenic
1041374743 8:57202549-57202571 CGGAGCCCTAAGGCCAAATTGGG - Intergenic
1048744638 8:137600234-137600256 ATTATCCATCTGGCCAAATTTGG - Intergenic
1051731649 9:20149765-20149787 ACTAGCCCGTGGGCCAAATGTGG - Intergenic
1053219352 9:36298954-36298976 GCAAGCCCTATTGCCAAATGTGG - Intronic
1056164154 9:83925452-83925474 CTTGGCCCTATGGTCAAATTGGG + Intergenic
1195631310 X:107058528-107058550 ACTAGCTCTATAACCAAATCTGG - Intergenic
1199078422 X:143549953-143549975 AGTAGCCCTCTGGTCAAATAGGG + Intergenic