ID: 1071820912

View in Genome Browser
Species Human (GRCh38)
Location 10:89279757-89279779
Sequence CTGTACTTAAGTAAGGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071820908_1071820912 -8 Left 1071820908 10:89279742-89279764 CCTGGCCTATACACACTGTACTT 0: 1
1: 0
2: 0
3: 9
4: 159
Right 1071820912 10:89279757-89279779 CTGTACTTAAGTAAGGAAGTGGG No data
1071820907_1071820912 -2 Left 1071820907 10:89279736-89279758 CCTAAACCTGGCCTATACACACT No data
Right 1071820912 10:89279757-89279779 CTGTACTTAAGTAAGGAAGTGGG No data
1071820906_1071820912 2 Left 1071820906 10:89279732-89279754 CCAGCCTAAACCTGGCCTATACA 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1071820912 10:89279757-89279779 CTGTACTTAAGTAAGGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071820912 Original CRISPR CTGTACTTAAGTAAGGAAGT GGG Intronic
No off target data available for this crispr