ID: 1071822536

View in Genome Browser
Species Human (GRCh38)
Location 10:89293017-89293039
Sequence TTTGAGATGAGATTTGGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071822536_1071822549 23 Left 1071822536 10:89293017-89293039 CCCCACCCAAATCTCATCTCAAA No data
Right 1071822549 10:89293063-89293085 TGTCAAGGGCAGGACCTGATGGG No data
1071822536_1071822548 22 Left 1071822536 10:89293017-89293039 CCCCACCCAAATCTCATCTCAAA No data
Right 1071822548 10:89293062-89293084 GTGTCAAGGGCAGGACCTGATGG No data
1071822536_1071822550 26 Left 1071822536 10:89293017-89293039 CCCCACCCAAATCTCATCTCAAA No data
Right 1071822550 10:89293066-89293088 CAAGGGCAGGACCTGATGGGAGG No data
1071822536_1071822546 13 Left 1071822536 10:89293017-89293039 CCCCACCCAAATCTCATCTCAAA No data
Right 1071822546 10:89293053-89293075 AATCCTCATGTGTCAAGGGCAGG No data
1071822536_1071822545 9 Left 1071822536 10:89293017-89293039 CCCCACCCAAATCTCATCTCAAA No data
Right 1071822545 10:89293049-89293071 CCATAATCCTCATGTGTCAAGGG No data
1071822536_1071822543 8 Left 1071822536 10:89293017-89293039 CCCCACCCAAATCTCATCTCAAA No data
Right 1071822543 10:89293048-89293070 CCCATAATCCTCATGTGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071822536 Original CRISPR TTTGAGATGAGATTTGGGTG GGG (reversed) Intronic