ID: 1071822540

View in Genome Browser
Species Human (GRCh38)
Location 10:89293023-89293045
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071822540_1071822550 20 Left 1071822540 10:89293023-89293045 CCAAATCTCATCTCAAATTATAA No data
Right 1071822550 10:89293066-89293088 CAAGGGCAGGACCTGATGGGAGG No data
1071822540_1071822543 2 Left 1071822540 10:89293023-89293045 CCAAATCTCATCTCAAATTATAA No data
Right 1071822543 10:89293048-89293070 CCCATAATCCTCATGTGTCAAGG No data
1071822540_1071822545 3 Left 1071822540 10:89293023-89293045 CCAAATCTCATCTCAAATTATAA No data
Right 1071822545 10:89293049-89293071 CCATAATCCTCATGTGTCAAGGG No data
1071822540_1071822551 25 Left 1071822540 10:89293023-89293045 CCAAATCTCATCTCAAATTATAA No data
Right 1071822551 10:89293071-89293093 GCAGGACCTGATGGGAGGATTGG No data
1071822540_1071822549 17 Left 1071822540 10:89293023-89293045 CCAAATCTCATCTCAAATTATAA No data
Right 1071822549 10:89293063-89293085 TGTCAAGGGCAGGACCTGATGGG No data
1071822540_1071822546 7 Left 1071822540 10:89293023-89293045 CCAAATCTCATCTCAAATTATAA No data
Right 1071822546 10:89293053-89293075 AATCCTCATGTGTCAAGGGCAGG No data
1071822540_1071822548 16 Left 1071822540 10:89293023-89293045 CCAAATCTCATCTCAAATTATAA No data
Right 1071822548 10:89293062-89293084 GTGTCAAGGGCAGGACCTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071822540 Original CRISPR TTATAATTTGAGATGAGATT TGG (reversed) Intronic