ID: 1071822541

View in Genome Browser
Species Human (GRCh38)
Location 10:89293047-89293069
Sequence CTTGACACATGAGGATTATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071822541_1071822556 14 Left 1071822541 10:89293047-89293069 CCCCATAATCCTCATGTGTCAAG No data
Right 1071822556 10:89293084-89293106 GGAGGATTGGATCATAGGGGTGG No data
1071822541_1071822549 -7 Left 1071822541 10:89293047-89293069 CCCCATAATCCTCATGTGTCAAG No data
Right 1071822549 10:89293063-89293085 TGTCAAGGGCAGGACCTGATGGG No data
1071822541_1071822553 9 Left 1071822541 10:89293047-89293069 CCCCATAATCCTCATGTGTCAAG No data
Right 1071822553 10:89293079-89293101 TGATGGGAGGATTGGATCATAGG No data
1071822541_1071822548 -8 Left 1071822541 10:89293047-89293069 CCCCATAATCCTCATGTGTCAAG No data
Right 1071822548 10:89293062-89293084 GTGTCAAGGGCAGGACCTGATGG No data
1071822541_1071822555 11 Left 1071822541 10:89293047-89293069 CCCCATAATCCTCATGTGTCAAG No data
Right 1071822555 10:89293081-89293103 ATGGGAGGATTGGATCATAGGGG No data
1071822541_1071822551 1 Left 1071822541 10:89293047-89293069 CCCCATAATCCTCATGTGTCAAG No data
Right 1071822551 10:89293071-89293093 GCAGGACCTGATGGGAGGATTGG No data
1071822541_1071822554 10 Left 1071822541 10:89293047-89293069 CCCCATAATCCTCATGTGTCAAG No data
Right 1071822554 10:89293080-89293102 GATGGGAGGATTGGATCATAGGG No data
1071822541_1071822550 -4 Left 1071822541 10:89293047-89293069 CCCCATAATCCTCATGTGTCAAG No data
Right 1071822550 10:89293066-89293088 CAAGGGCAGGACCTGATGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071822541 Original CRISPR CTTGACACATGAGGATTATG GGG (reversed) Intronic