ID: 1071822549

View in Genome Browser
Species Human (GRCh38)
Location 10:89293063-89293085
Sequence TGTCAAGGGCAGGACCTGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071822542_1071822549 -8 Left 1071822542 10:89293048-89293070 CCCATAATCCTCATGTGTCAAGG No data
Right 1071822549 10:89293063-89293085 TGTCAAGGGCAGGACCTGATGGG No data
1071822538_1071822549 21 Left 1071822538 10:89293019-89293041 CCACCCAAATCTCATCTCAAATT No data
Right 1071822549 10:89293063-89293085 TGTCAAGGGCAGGACCTGATGGG No data
1071822537_1071822549 22 Left 1071822537 10:89293018-89293040 CCCACCCAAATCTCATCTCAAAT No data
Right 1071822549 10:89293063-89293085 TGTCAAGGGCAGGACCTGATGGG No data
1071822541_1071822549 -7 Left 1071822541 10:89293047-89293069 CCCCATAATCCTCATGTGTCAAG No data
Right 1071822549 10:89293063-89293085 TGTCAAGGGCAGGACCTGATGGG No data
1071822540_1071822549 17 Left 1071822540 10:89293023-89293045 CCAAATCTCATCTCAAATTATAA No data
Right 1071822549 10:89293063-89293085 TGTCAAGGGCAGGACCTGATGGG No data
1071822536_1071822549 23 Left 1071822536 10:89293017-89293039 CCCCACCCAAATCTCATCTCAAA No data
Right 1071822549 10:89293063-89293085 TGTCAAGGGCAGGACCTGATGGG No data
1071822539_1071822549 18 Left 1071822539 10:89293022-89293044 CCCAAATCTCATCTCAAATTATA No data
Right 1071822549 10:89293063-89293085 TGTCAAGGGCAGGACCTGATGGG No data
1071822544_1071822549 -9 Left 1071822544 10:89293049-89293071 CCATAATCCTCATGTGTCAAGGG No data
Right 1071822549 10:89293063-89293085 TGTCAAGGGCAGGACCTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071822549 Original CRISPR TGTCAAGGGCAGGACCTGAT GGG Intronic