ID: 1071822549

View in Genome Browser
Species Human (GRCh38)
Location 10:89293063-89293085
Sequence TGTCAAGGGCAGGACCTGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1071822539_1071822549 18 Left 1071822539 10:89293022-89293044 CCCAAATCTCATCTCAAATTATA 0: 85
1: 954
2: 3313
3: 11268
4: 12354
Right 1071822549 10:89293063-89293085 TGTCAAGGGCAGGACCTGATGGG No data
1071822538_1071822549 21 Left 1071822538 10:89293019-89293041 CCACCCAAATCTCATCTCAAATT 0: 639
1: 2054
2: 10290
3: 12845
4: 9442
Right 1071822549 10:89293063-89293085 TGTCAAGGGCAGGACCTGATGGG No data
1071822540_1071822549 17 Left 1071822540 10:89293023-89293045 CCAAATCTCATCTCAAATTATAA 0: 87
1: 929
2: 2641
3: 6367
4: 13813
Right 1071822549 10:89293063-89293085 TGTCAAGGGCAGGACCTGATGGG No data
1071822544_1071822549 -9 Left 1071822544 10:89293049-89293071 CCATAATCCTCATGTGTCAAGGG 0: 19
1: 283
2: 1075
3: 1929
4: 3035
Right 1071822549 10:89293063-89293085 TGTCAAGGGCAGGACCTGATGGG No data
1071822537_1071822549 22 Left 1071822537 10:89293018-89293040 CCCACCCAAATCTCATCTCAAAT 0: 673
1: 1973
2: 10309
3: 12710
4: 10112
Right 1071822549 10:89293063-89293085 TGTCAAGGGCAGGACCTGATGGG No data
1071822542_1071822549 -8 Left 1071822542 10:89293048-89293070 CCCATAATCCTCATGTGTCAAGG 0: 25
1: 272
2: 1101
3: 1982
4: 3049
Right 1071822549 10:89293063-89293085 TGTCAAGGGCAGGACCTGATGGG No data
1071822536_1071822549 23 Left 1071822536 10:89293017-89293039 CCCCACCCAAATCTCATCTCAAA 0: 636
1: 1979
2: 10095
3: 12822
4: 9433
Right 1071822549 10:89293063-89293085 TGTCAAGGGCAGGACCTGATGGG No data
1071822541_1071822549 -7 Left 1071822541 10:89293047-89293069 CCCCATAATCCTCATGTGTCAAG 0: 12
1: 221
2: 556
3: 759
4: 1006
Right 1071822549 10:89293063-89293085 TGTCAAGGGCAGGACCTGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1071822549 Original CRISPR TGTCAAGGGCAGGACCTGAT GGG Intronic
No off target data available for this crispr